ID: 1117459344

View in Genome Browser
Species Human (GRCh38)
Location 14:55929282-55929304
Sequence GAAGTGATCTCTGCATGGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117459344_1117459349 8 Left 1117459344 14:55929282-55929304 CCCTTCCATGCAGAGATCACTTC No data
Right 1117459349 14:55929313-55929335 CCAATTGGCGAAAATGTAGTTGG No data
1117459344_1117459351 12 Left 1117459344 14:55929282-55929304 CCCTTCCATGCAGAGATCACTTC No data
Right 1117459351 14:55929317-55929339 TTGGCGAAAATGTAGTTGGGTGG No data
1117459344_1117459347 -7 Left 1117459344 14:55929282-55929304 CCCTTCCATGCAGAGATCACTTC No data
Right 1117459347 14:55929298-55929320 TCACTTCACATGTATCCAATTGG No data
1117459344_1117459350 9 Left 1117459344 14:55929282-55929304 CCCTTCCATGCAGAGATCACTTC No data
Right 1117459350 14:55929314-55929336 CAATTGGCGAAAATGTAGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117459344 Original CRISPR GAAGTGATCTCTGCATGGAA GGG (reversed) Intergenic
No off target data available for this crispr