ID: 1117459345

View in Genome Browser
Species Human (GRCh38)
Location 14:55929283-55929305
Sequence TGAAGTGATCTCTGCATGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117459345_1117459351 11 Left 1117459345 14:55929283-55929305 CCTTCCATGCAGAGATCACTTCA No data
Right 1117459351 14:55929317-55929339 TTGGCGAAAATGTAGTTGGGTGG No data
1117459345_1117459347 -8 Left 1117459345 14:55929283-55929305 CCTTCCATGCAGAGATCACTTCA No data
Right 1117459347 14:55929298-55929320 TCACTTCACATGTATCCAATTGG No data
1117459345_1117459350 8 Left 1117459345 14:55929283-55929305 CCTTCCATGCAGAGATCACTTCA No data
Right 1117459350 14:55929314-55929336 CAATTGGCGAAAATGTAGTTGGG No data
1117459345_1117459349 7 Left 1117459345 14:55929283-55929305 CCTTCCATGCAGAGATCACTTCA No data
Right 1117459349 14:55929313-55929335 CCAATTGGCGAAAATGTAGTTGG No data
1117459345_1117459352 30 Left 1117459345 14:55929283-55929305 CCTTCCATGCAGAGATCACTTCA No data
Right 1117459352 14:55929336-55929358 GTGGCCACACTTAGCTTCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117459345 Original CRISPR TGAAGTGATCTCTGCATGGA AGG (reversed) Intergenic