ID: 1117459346

View in Genome Browser
Species Human (GRCh38)
Location 14:55929287-55929309
Sequence CATGTGAAGTGATCTCTGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117459346_1117459353 29 Left 1117459346 14:55929287-55929309 CCATGCAGAGATCACTTCACATG No data
Right 1117459353 14:55929339-55929361 GCCACACTTAGCTTCAAAGGAGG No data
1117459346_1117459349 3 Left 1117459346 14:55929287-55929309 CCATGCAGAGATCACTTCACATG No data
Right 1117459349 14:55929313-55929335 CCAATTGGCGAAAATGTAGTTGG No data
1117459346_1117459351 7 Left 1117459346 14:55929287-55929309 CCATGCAGAGATCACTTCACATG No data
Right 1117459351 14:55929317-55929339 TTGGCGAAAATGTAGTTGGGTGG No data
1117459346_1117459350 4 Left 1117459346 14:55929287-55929309 CCATGCAGAGATCACTTCACATG No data
Right 1117459350 14:55929314-55929336 CAATTGGCGAAAATGTAGTTGGG No data
1117459346_1117459352 26 Left 1117459346 14:55929287-55929309 CCATGCAGAGATCACTTCACATG No data
Right 1117459352 14:55929336-55929358 GTGGCCACACTTAGCTTCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117459346 Original CRISPR CATGTGAAGTGATCTCTGCA TGG (reversed) Intergenic
No off target data available for this crispr