ID: 1117459347

View in Genome Browser
Species Human (GRCh38)
Location 14:55929298-55929320
Sequence TCACTTCACATGTATCCAAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117459344_1117459347 -7 Left 1117459344 14:55929282-55929304 CCCTTCCATGCAGAGATCACTTC No data
Right 1117459347 14:55929298-55929320 TCACTTCACATGTATCCAATTGG No data
1117459343_1117459347 -3 Left 1117459343 14:55929278-55929300 CCTTCCCTTCCATGCAGAGATCA No data
Right 1117459347 14:55929298-55929320 TCACTTCACATGTATCCAATTGG No data
1117459341_1117459347 -1 Left 1117459341 14:55929276-55929298 CCCCTTCCCTTCCATGCAGAGAT No data
Right 1117459347 14:55929298-55929320 TCACTTCACATGTATCCAATTGG No data
1117459342_1117459347 -2 Left 1117459342 14:55929277-55929299 CCCTTCCCTTCCATGCAGAGATC No data
Right 1117459347 14:55929298-55929320 TCACTTCACATGTATCCAATTGG No data
1117459345_1117459347 -8 Left 1117459345 14:55929283-55929305 CCTTCCATGCAGAGATCACTTCA No data
Right 1117459347 14:55929298-55929320 TCACTTCACATGTATCCAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117459347 Original CRISPR TCACTTCACATGTATCCAAT TGG Intergenic
No off target data available for this crispr