ID: 1117459348

View in Genome Browser
Species Human (GRCh38)
Location 14:55929313-55929335
Sequence CCAACTACATTTTCGCCAAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117459348_1117459352 0 Left 1117459348 14:55929313-55929335 CCAATTGGCGAAAATGTAGTTGG No data
Right 1117459352 14:55929336-55929358 GTGGCCACACTTAGCTTCAAAGG No data
1117459348_1117459353 3 Left 1117459348 14:55929313-55929335 CCAATTGGCGAAAATGTAGTTGG No data
Right 1117459353 14:55929339-55929361 GCCACACTTAGCTTCAAAGGAGG No data
1117459348_1117459356 8 Left 1117459348 14:55929313-55929335 CCAATTGGCGAAAATGTAGTTGG No data
Right 1117459356 14:55929344-55929366 ACTTAGCTTCAAAGGAGGCTGGG No data
1117459348_1117459355 7 Left 1117459348 14:55929313-55929335 CCAATTGGCGAAAATGTAGTTGG No data
Right 1117459355 14:55929343-55929365 CACTTAGCTTCAAAGGAGGCTGG No data
1117459348_1117459357 28 Left 1117459348 14:55929313-55929335 CCAATTGGCGAAAATGTAGTTGG No data
Right 1117459357 14:55929364-55929386 GGGAAATGTAGTTCGTACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117459348 Original CRISPR CCAACTACATTTTCGCCAAT TGG (reversed) Intergenic