ID: 1117459349

View in Genome Browser
Species Human (GRCh38)
Location 14:55929313-55929335
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117459343_1117459349 12 Left 1117459343 14:55929278-55929300 CCTTCCCTTCCATGCAGAGATCA No data
Right 1117459349 14:55929313-55929335 CCAATTGGCGAAAATGTAGTTGG No data
1117459345_1117459349 7 Left 1117459345 14:55929283-55929305 CCTTCCATGCAGAGATCACTTCA No data
Right 1117459349 14:55929313-55929335 CCAATTGGCGAAAATGTAGTTGG No data
1117459341_1117459349 14 Left 1117459341 14:55929276-55929298 CCCCTTCCCTTCCATGCAGAGAT No data
Right 1117459349 14:55929313-55929335 CCAATTGGCGAAAATGTAGTTGG No data
1117459346_1117459349 3 Left 1117459346 14:55929287-55929309 CCATGCAGAGATCACTTCACATG No data
Right 1117459349 14:55929313-55929335 CCAATTGGCGAAAATGTAGTTGG No data
1117459344_1117459349 8 Left 1117459344 14:55929282-55929304 CCCTTCCATGCAGAGATCACTTC No data
Right 1117459349 14:55929313-55929335 CCAATTGGCGAAAATGTAGTTGG No data
1117459342_1117459349 13 Left 1117459342 14:55929277-55929299 CCCTTCCCTTCCATGCAGAGATC No data
Right 1117459349 14:55929313-55929335 CCAATTGGCGAAAATGTAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117459349 Original CRISPR CCAATTGGCGAAAATGTAGT TGG Intergenic