ID: 1117459351

View in Genome Browser
Species Human (GRCh38)
Location 14:55929317-55929339
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117459343_1117459351 16 Left 1117459343 14:55929278-55929300 CCTTCCCTTCCATGCAGAGATCA No data
Right 1117459351 14:55929317-55929339 TTGGCGAAAATGTAGTTGGGTGG No data
1117459344_1117459351 12 Left 1117459344 14:55929282-55929304 CCCTTCCATGCAGAGATCACTTC No data
Right 1117459351 14:55929317-55929339 TTGGCGAAAATGTAGTTGGGTGG No data
1117459341_1117459351 18 Left 1117459341 14:55929276-55929298 CCCCTTCCCTTCCATGCAGAGAT No data
Right 1117459351 14:55929317-55929339 TTGGCGAAAATGTAGTTGGGTGG No data
1117459342_1117459351 17 Left 1117459342 14:55929277-55929299 CCCTTCCCTTCCATGCAGAGATC No data
Right 1117459351 14:55929317-55929339 TTGGCGAAAATGTAGTTGGGTGG No data
1117459345_1117459351 11 Left 1117459345 14:55929283-55929305 CCTTCCATGCAGAGATCACTTCA No data
Right 1117459351 14:55929317-55929339 TTGGCGAAAATGTAGTTGGGTGG No data
1117459346_1117459351 7 Left 1117459346 14:55929287-55929309 CCATGCAGAGATCACTTCACATG No data
Right 1117459351 14:55929317-55929339 TTGGCGAAAATGTAGTTGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117459351 Original CRISPR TTGGCGAAAATGTAGTTGGG TGG Intergenic
No off target data available for this crispr