ID: 1117459352

View in Genome Browser
Species Human (GRCh38)
Location 14:55929336-55929358
Sequence GTGGCCACACTTAGCTTCAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117459348_1117459352 0 Left 1117459348 14:55929313-55929335 CCAATTGGCGAAAATGTAGTTGG No data
Right 1117459352 14:55929336-55929358 GTGGCCACACTTAGCTTCAAAGG No data
1117459345_1117459352 30 Left 1117459345 14:55929283-55929305 CCTTCCATGCAGAGATCACTTCA No data
Right 1117459352 14:55929336-55929358 GTGGCCACACTTAGCTTCAAAGG No data
1117459346_1117459352 26 Left 1117459346 14:55929287-55929309 CCATGCAGAGATCACTTCACATG No data
Right 1117459352 14:55929336-55929358 GTGGCCACACTTAGCTTCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117459352 Original CRISPR GTGGCCACACTTAGCTTCAA AGG Intergenic
No off target data available for this crispr