ID: 1117459353

View in Genome Browser
Species Human (GRCh38)
Location 14:55929339-55929361
Sequence GCCACACTTAGCTTCAAAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117459346_1117459353 29 Left 1117459346 14:55929287-55929309 CCATGCAGAGATCACTTCACATG No data
Right 1117459353 14:55929339-55929361 GCCACACTTAGCTTCAAAGGAGG No data
1117459348_1117459353 3 Left 1117459348 14:55929313-55929335 CCAATTGGCGAAAATGTAGTTGG No data
Right 1117459353 14:55929339-55929361 GCCACACTTAGCTTCAAAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117459353 Original CRISPR GCCACACTTAGCTTCAAAGG AGG Intergenic
No off target data available for this crispr