ID: 1117459354

View in Genome Browser
Species Human (GRCh38)
Location 14:55929340-55929362
Sequence GCCTCCTTTGAAGCTAAGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117459354_1117459359 18 Left 1117459354 14:55929340-55929362 CCACACTTAGCTTCAAAGGAGGC No data
Right 1117459359 14:55929381-55929403 CCCAGGTGAAAACTCAGAAGAGG No data
1117459354_1117459357 1 Left 1117459354 14:55929340-55929362 CCACACTTAGCTTCAAAGGAGGC No data
Right 1117459357 14:55929364-55929386 GGGAAATGTAGTTCGTACCCAGG No data
1117459354_1117459361 19 Left 1117459354 14:55929340-55929362 CCACACTTAGCTTCAAAGGAGGC No data
Right 1117459361 14:55929382-55929404 CCAGGTGAAAACTCAGAAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117459354 Original CRISPR GCCTCCTTTGAAGCTAAGTG TGG (reversed) Intergenic
No off target data available for this crispr