ID: 1117459355

View in Genome Browser
Species Human (GRCh38)
Location 14:55929343-55929365
Sequence CACTTAGCTTCAAAGGAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117459348_1117459355 7 Left 1117459348 14:55929313-55929335 CCAATTGGCGAAAATGTAGTTGG No data
Right 1117459355 14:55929343-55929365 CACTTAGCTTCAAAGGAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117459355 Original CRISPR CACTTAGCTTCAAAGGAGGC TGG Intergenic
No off target data available for this crispr