ID: 1117459357

View in Genome Browser
Species Human (GRCh38)
Location 14:55929364-55929386
Sequence GGGAAATGTAGTTCGTACCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117459348_1117459357 28 Left 1117459348 14:55929313-55929335 CCAATTGGCGAAAATGTAGTTGG No data
Right 1117459357 14:55929364-55929386 GGGAAATGTAGTTCGTACCCAGG No data
1117459354_1117459357 1 Left 1117459354 14:55929340-55929362 CCACACTTAGCTTCAAAGGAGGC No data
Right 1117459357 14:55929364-55929386 GGGAAATGTAGTTCGTACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117459357 Original CRISPR GGGAAATGTAGTTCGTACCC AGG Intergenic
No off target data available for this crispr