ID: 1117478828

View in Genome Browser
Species Human (GRCh38)
Location 14:56122668-56122690
Sequence TAGGGTCCACAGATGGAGTT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 154}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117478825_1117478828 -7 Left 1117478825 14:56122652-56122674 CCAAGGGTTCTTAACCTAGGGTC 0: 1
1: 0
2: 2
3: 22
4: 124
Right 1117478828 14:56122668-56122690 TAGGGTCCACAGATGGAGTTCGG 0: 1
1: 0
2: 0
3: 8
4: 154

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117478828 Original CRISPR TAGGGTCCACAGATGGAGTT CGG Intronic
901403763 1:9032275-9032297 TAGGGTCTATAGCTGCAGTTTGG + Intergenic
902333813 1:15743569-15743591 TATGGTCAACAGATAGAGTCAGG + Intronic
903314546 1:22491516-22491538 AAAGGTCCACAGAAGGAGGTAGG + Exonic
904861761 1:33543257-33543279 TAGGGTCCACACATGACATTTGG + Intronic
905738891 1:40352186-40352208 CTGGGTCCACAGATGGACTTTGG - Intronic
915751212 1:158212764-158212786 CTGGGTCCACAGCTGCAGTTTGG - Intergenic
920242687 1:204564862-204564884 TAGGGTCCACAGATGGTTCTAGG - Intergenic
921521623 1:216162772-216162794 AAGGATGCACACATGGAGTTTGG - Intronic
921522858 1:216177920-216177942 GAAAGTCCACAGATGTAGTTTGG - Intronic
922944840 1:229504596-229504618 TAGGATCCAGAAATGGAGGTAGG + Intronic
1062831648 10:609777-609799 TAAGATCCAAAGATGCAGTTAGG - Intronic
1063529319 10:6815760-6815782 TGGGGACCACAGCTGGAGTGTGG - Intergenic
1065012074 10:21429926-21429948 GAGGGCCCACATATGCAGTTTGG + Intergenic
1070810961 10:79297967-79297989 CAGGGTCCCCAGGTGGAGTCGGG - Intronic
1072154852 10:92715055-92715077 TTGCGTCCACAGCTGCAGTTTGG + Intergenic
1072299020 10:94041153-94041175 TAGGGTCCAGGGTGGGAGTTGGG - Intronic
1076516920 10:131050986-131051008 TAGGGTACACAGCTGGACTGGGG + Intergenic
1080754246 11:35180317-35180339 TTTGCTGCACAGATGGAGTTGGG - Exonic
1081914881 11:46724317-46724339 TAGGGTCAACTGACGGAGGTTGG + Intronic
1085962541 11:81479805-81479827 TAGTGTTCACACATGGACTTTGG - Intergenic
1088397284 11:109382634-109382656 TTGGGTTGACAGATGGGGTTTGG + Intergenic
1092238721 12:6824908-6824930 TGGGGGCCACAAATGGAGTGGGG - Intronic
1093493182 12:19726871-19726893 CAGGGTCCACAGCTGCAGCTTGG + Intergenic
1094817063 12:34198382-34198404 TTGGGGCCACAGGTGGTGTTTGG - Intergenic
1097076361 12:56397547-56397569 TCGGATCCACAGATGCAGTTTGG + Intergenic
1098981223 12:76958396-76958418 TAGGGTCCACAGAGTGAGGAAGG - Intergenic
1101966058 12:109282797-109282819 TAGGGTCCCCAGATCTATTTGGG + Intronic
1102406987 12:112681978-112682000 TTGGTTCCACAAATGGTGTTTGG + Intronic
1104691262 12:130828094-130828116 TAGGGTCTTCTGATGGAGATGGG - Intronic
1105425259 13:20289017-20289039 TTGGATCCACAGCTGCAGTTTGG - Intergenic
1107410232 13:40151497-40151519 AATGGTCCACAGATGGAGACAGG - Intergenic
1109426127 13:62168009-62168031 CTGGGTCCACAGCTGCAGTTTGG - Intergenic
1110008075 13:70297222-70297244 TGGGATCCACAGCTGCAGTTTGG - Intergenic
1115542850 14:34438966-34438988 TAGGATCCACAGAAGTAGATAGG + Intronic
1116025317 14:39507309-39507331 TAGGTACCACTGATAGAGTTGGG - Intergenic
1116863923 14:50016185-50016207 AAGGGTCCAGAGATGGGGATTGG + Intergenic
1117478828 14:56122668-56122690 TAGGGTCCACAGATGGAGTTCGG + Intronic
1120645705 14:87071521-87071543 TGGGGAACACAGATGGAGTAGGG + Intergenic
1121795621 14:96732981-96733003 AAGGACCCACAGTTGGAGTTAGG + Intergenic
1124937439 15:34186395-34186417 TGGGATCCACAGCTGCAGTTTGG - Intronic
1125875185 15:43137968-43137990 TAGGGGCCAGGGCTGGAGTTGGG - Intronic
1128847769 15:70916868-70916890 CTGGGTCCACAGCTGCAGTTTGG - Intronic
1130760883 15:86818505-86818527 CAGGGACCACAGTTGGGGTTTGG - Intronic
1132360354 15:101207881-101207903 TAGGGTCCCCAGATGGGGTGAGG + Intronic
1136709287 16:32222024-32222046 TAGGGTCTTCAGAGGGAGTATGG - Intergenic
1136758623 16:32707395-32707417 TAGGGTCTTCAGAGGGAGTATGG + Intergenic
1136809485 16:33162984-33163006 TAGGGTCTTCAGAGGGAGTATGG - Intergenic
1136815961 16:33273064-33273086 TAGGGTCTTCAGAGGGAGTATGG - Intronic
1137256257 16:46777957-46777979 TCGGATCCACAGCTGTAGTTTGG - Intronic
1138408738 16:56821100-56821122 TAGGGTTCATGGATGGAGTGGGG - Intronic
1139183024 16:64770275-64770297 CTGGGTCCACAGGTGCAGTTTGG - Intergenic
1140033344 16:71355564-71355586 TTTGGGCCACATATGGAGTTGGG - Intergenic
1140284990 16:73594601-73594623 TAGAGTCTAGAGGTGGAGTTGGG + Intergenic
1142140849 16:88472098-88472120 CTGGGTCCACAGATGGGGTGGGG - Intronic
1142280921 16:89147167-89147189 GAGGGTCCACAGAGGGAGGGAGG + Intronic
1142280930 16:89147216-89147238 GAGGGTCCACAGAGTGAGTGAGG + Intronic
1142281005 16:89147476-89147498 GAGGGTCCACAGAGTGAGTGAGG + Intronic
1142425917 16:90002249-90002271 TAGGTCCCTCAGATGGAGGTGGG + Intergenic
1203060777 16_KI270728v1_random:967723-967745 TAGGGTCTTCAGAGGGAGTATGG + Intergenic
1143652236 17:8270497-8270519 TGGGGTCCACAGATGGTGAGGGG + Intergenic
1148622555 17:49045271-49045293 TAAGGTCCACAGAAGAAGATGGG + Intronic
1148958512 17:51373846-51373868 TAGGGACCACAAATGTACTTCGG + Intergenic
1149088584 17:52751025-52751047 TCGGATCCACAGTTGCAGTTTGG - Intergenic
1156298963 18:35818393-35818415 CCGGGTCCACAGCTGGGGTTTGG + Intergenic
1157636987 18:49168511-49168533 TAGGGTACACAGATGGTGGCAGG + Intronic
1159186595 18:64983695-64983717 TTGGATCCACAGCTGCAGTTGGG - Intergenic
1162015451 19:7844444-7844466 TCAGAACCACAGATGGAGTTGGG - Intronic
1164598951 19:29548402-29548424 AAGGGGCCACTGATGCAGTTGGG - Intronic
1164794181 19:31013325-31013347 TAAGGTCCACACATTGTGTTTGG + Intergenic
1165027073 19:32969809-32969831 TCGGATCCACAGCTGCAGTTTGG + Intronic
1165382598 19:35491831-35491853 TAGGGTGCCCAGTTGGAGATGGG + Intronic
1166464268 19:43018536-43018558 CAGGGTCCACAGATTGTGATGGG - Intronic
1167881396 19:52461554-52461576 TAAGGGCCAGAGAAGGAGTTTGG - Intronic
1168084422 19:54034867-54034889 TCGGATCCACAGCTGGGGTTTGG - Intergenic
927253698 2:21021033-21021055 TGGGCTCCACATATGGATTTGGG - Intronic
929568957 2:43007733-43007755 CATGGTCCCCAGATGGACTTAGG + Intergenic
929947058 2:46379750-46379772 GAGAGTCCACAGATGGACCTGGG + Intronic
934681830 2:96289425-96289447 TATGGTCCACAGTTAGAGGTTGG - Intronic
938379896 2:130830663-130830685 TAGGGAGCACAGATGAAGATGGG - Intergenic
940930287 2:159421092-159421114 TTTGGTCCACAGATGTAGTGAGG - Intronic
944863679 2:203839901-203839923 TAGAGTCCCCAAATGGAGTGTGG - Intergenic
946164542 2:217856057-217856079 TGGGATCCACAGATGGTTTTTGG - Intronic
949039560 2:241841524-241841546 CAGGGTCCACAGCTCGAATTGGG - Intergenic
1173251230 20:41365222-41365244 TGAGGCCCACAGATGGAGGTGGG - Intronic
1173524591 20:43721913-43721935 TTGGATCCACAGCTGCAGTTTGG + Intergenic
1175535316 20:59706915-59706937 TAAGGTCCACAGATGATGTGAGG - Intronic
1178313030 21:31545310-31545332 TAGGGCCCTCAGAGGGAGTGTGG + Intronic
1181531518 22:23520176-23520198 TAGGGTCCACAGTGGCAGTCTGG - Intergenic
1183750784 22:39719245-39719267 TAGGGAAGAGAGATGGAGTTGGG - Intergenic
1184142728 22:42587685-42587707 CTGGCTCCACAGATGGAGATGGG + Intronic
950636122 3:14316183-14316205 TAAGTGCCACAGATGGACTTTGG + Intergenic
954651003 3:52162616-52162638 TAGGATCCATAGCTGCAGTTTGG + Intergenic
955949822 3:64231853-64231875 AAGGGTCCACAGCTGAAGTTTGG + Intronic
957705036 3:83770065-83770087 TGGGATCCACAGCTGCAGTTTGG - Intergenic
961086048 3:124068242-124068264 TGAGTTCCACAGATGGAGGTGGG - Intergenic
961249434 3:125487930-125487952 TAGGGTTCACACTTGGTGTTGGG - Intronic
963227260 3:142874896-142874918 TAGGGTACACAGAGGTAGTTAGG + Intronic
963906313 3:150776202-150776224 CAGGGTCCACAGATTGCATTTGG + Intergenic
964192452 3:154019265-154019287 TAGGATCCACTGATGGATTCAGG - Intergenic
964442838 3:156729627-156729649 CAGCGTCCAGAGAGGGAGTTGGG + Intergenic
964791950 3:160460731-160460753 TCGGATCCACAGCTGCAGTTTGG + Intronic
965573574 3:170195380-170195402 TAGGCTCCATAGAATGAGTTAGG - Intergenic
966151178 3:176869048-176869070 TAGGGTCCAGAAATGCAGTCTGG - Intergenic
968147894 3:196314893-196314915 TATGCTCTACAGATGTAGTTTGG + Intronic
969664270 4:8548123-8548145 TAGGCCCCACACATGGAGATGGG + Intergenic
973681045 4:53320217-53320239 TATGGTAAACAGATGGATTTTGG - Intronic
974596827 4:64024357-64024379 TAGGGTCCAATGATTTAGTTGGG + Intergenic
974874908 4:67692040-67692062 TGGGGTACACAGGTGGTGTTTGG + Intronic
978346021 4:107770479-107770501 TAGGGTCTATAGATCAAGTTGGG - Intergenic
978524840 4:109654879-109654901 TAGGGCACCCAGATGGTGTTTGG - Intronic
984279334 4:177650141-177650163 CAGGGTTCACAGATGGACATAGG - Intergenic
984731009 4:183068312-183068334 TAGGATCCACAGATAGCCTTTGG - Intergenic
987284297 5:16440601-16440623 TAGTGTCCAGGAATGGAGTTGGG + Intergenic
987449689 5:18066789-18066811 AAGGGTCCAAGGATGAAGTTGGG + Intergenic
990501549 5:56401339-56401361 TAGGGTTCACAGATGCATATTGG + Intergenic
991413912 5:66371730-66371752 AAGTGTCCCCAGATGAAGTTAGG - Intergenic
991632273 5:68668027-68668049 ATGGAACCACAGATGGAGTTAGG - Intergenic
993551390 5:89278144-89278166 TAGGATTCACAGATGGGGTCCGG + Intergenic
997618646 5:135270660-135270682 AAGGGGCCACAGATGGCTTTGGG + Intronic
1001681420 5:173559998-173560020 TAGAAGCCACAGATGGAGTGTGG + Intergenic
1002688909 5:181037080-181037102 TTGGATCCACAGCTGCAGTTTGG - Intergenic
1002693801 5:181070653-181070675 TCGGATCCACAGGTGCAGTTTGG + Intergenic
1003810002 6:9768557-9768579 CAGAGTCCAGAGATGGAATTAGG - Intronic
1007649840 6:43412649-43412671 CTGGGTCCACAGCTGGGGTTGGG - Intergenic
1013332264 6:109115680-109115702 AAGGGTCCACAGTTAGAGTCCGG + Intronic
1013488053 6:110617188-110617210 TAGGTTTCACAGCTGGTGTTGGG - Intronic
1015176550 6:130315859-130315881 TAGGATCCCCTGATGGACTTGGG + Intronic
1017596217 6:156031417-156031439 TAGGGTACACAGATTGTGTCTGG - Intergenic
1019070600 6:169341833-169341855 GAGGGTGCACAGATGGAGCCGGG - Intergenic
1020414867 7:7934214-7934236 TAGAGACCACATAGGGAGTTTGG - Intronic
1021336913 7:19414621-19414643 TTGGATCCACAGATTGAATTAGG + Intergenic
1023514715 7:40990078-40990100 TTGGTTCCACTGATGGATTTGGG - Intergenic
1023789002 7:43737317-43737339 TCGGATCCACAGCTGCAGTTTGG - Intergenic
1028308715 7:89301388-89301410 TAGGGTTCACAGGGTGAGTTTGG - Intronic
1033636705 7:143218623-143218645 TTGTGTTCACAGAAGGAGTTTGG - Intergenic
1037131582 8:15413262-15413284 ACGGGTCCACAGATGGAGAGAGG - Intergenic
1037795884 8:21994513-21994535 TAGGGTCCAGAGACGGTGTAGGG + Intronic
1043138105 8:76553120-76553142 TAGGTTCAACACATGGATTTTGG + Intergenic
1043375759 8:79647576-79647598 TAGTGTCAACAGATGGAATGGGG - Intronic
1051355644 9:16237706-16237728 TAGGGTTCAGAGATTGAGATTGG - Intronic
1053076481 9:35138793-35138815 TCGGATCCACAGCTGCAGTTTGG - Intergenic
1053617261 9:39781322-39781344 TTGGATCCACAGCTGCAGTTTGG - Intergenic
1053875444 9:42540685-42540707 TTGGATCCACAGCTGCAGTTTGG - Intergenic
1053897201 9:42753948-42753970 TTGGATCCACAGCTGCAGTTTGG + Intergenic
1054236256 9:62561039-62561061 TTGGATCCACAGCTGCAGTTTGG + Intergenic
1054266905 9:62926115-62926137 TTGGATCCACAGCTGCAGTTTGG + Intergenic
1054550398 9:66595569-66595591 TTGGATCCACAGCTGCAGTTTGG + Intergenic
1057945825 9:99327315-99327337 ACAGGTCCAAAGATGGAGTTTGG - Intergenic
1058554982 9:106157606-106157628 AATGGTCCACAGACTGAGTTAGG + Intergenic
1059707286 9:116837144-116837166 TAGAGTCCACAAAAGGAGTCTGG + Intronic
1061059296 9:128242767-128242789 AAGGATCCACGGGTGGAGTTGGG + Intronic
1061816912 9:133202875-133202897 TTGAGTCCAGACATGGAGTTAGG + Intergenic
1187424717 X:19166796-19166818 TCGAGGCCACAGCTGGAGTTTGG + Intergenic
1189082366 X:37988293-37988315 TAGAGTCCCCAGAGGGAGTATGG + Intronic
1189360061 X:40343483-40343505 TCGGATCCACAGCTGCAGTTTGG - Intergenic
1192139810 X:68638082-68638104 TGGGGGCCAGAGATGGAGCTGGG - Intergenic
1192534616 X:71916698-71916720 TGGCGTCCAAAGATGGAATTTGG + Intergenic
1192564238 X:72150162-72150184 TAGGGTGCACATATTGAATTTGG - Intergenic
1194401954 X:93448647-93448669 TAGGGGCCCCAAAAGGAGTTGGG - Intergenic
1194423699 X:93709482-93709504 TTGGGCCCACAGATTGAGTTGGG - Exonic
1199473995 X:148226137-148226159 CTGGTTCCTCAGATGGAGTTAGG + Intergenic
1200415853 Y:2909054-2909076 TAGGGTTCACAGTTGGTGTCAGG - Intronic
1201143873 Y:11051444-11051466 TAGATTCCTCAGATGGAGTTGGG + Intergenic