ID: 1117480562

View in Genome Browser
Species Human (GRCh38)
Location 14:56140020-56140042
Sequence CAGGAAAAAGAGAAGGGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2217
Summary {0: 1, 1: 1, 2: 22, 3: 206, 4: 1987}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117480562_1117480569 14 Left 1117480562 14:56140020-56140042 CCTTCCCCCTTCTCTTTTTCCTG 0: 1
1: 1
2: 22
3: 206
4: 1987
Right 1117480569 14:56140057-56140079 TAGCACATGTCTGAATGAAATGG 0: 1
1: 0
2: 2
3: 16
4: 175

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117480562 Original CRISPR CAGGAAAAAGAGAAGGGGGA AGG (reversed) Intronic
Too many off-targets to display for this crispr