ID: 1117481375

View in Genome Browser
Species Human (GRCh38)
Location 14:56148666-56148688
Sequence CAGAGAACACAGAAGAAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 893
Summary {0: 1, 1: 0, 2: 6, 3: 95, 4: 791}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117481375_1117481380 18 Left 1117481375 14:56148666-56148688 CCTCCTTTCTTCTGTGTTCTCTG 0: 1
1: 0
2: 6
3: 95
4: 791
Right 1117481380 14:56148707-56148729 CCTATTGTCCTTTGTCCCTAGGG 0: 1
1: 0
2: 1
3: 8
4: 127
1117481375_1117481378 17 Left 1117481375 14:56148666-56148688 CCTCCTTTCTTCTGTGTTCTCTG 0: 1
1: 0
2: 6
3: 95
4: 791
Right 1117481378 14:56148706-56148728 TCCTATTGTCCTTTGTCCCTAGG 0: 1
1: 0
2: 1
3: 14
4: 196

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117481375 Original CRISPR CAGAGAACACAGAAGAAAGG AGG (reversed) Intronic
900943081 1:5813751-5813773 AGGAGAACAGAGAAGGAAGGAGG + Intergenic
901173546 1:7282122-7282144 CAGAAAATCCAGAAGAAATGAGG - Intronic
901598208 1:10401629-10401651 CAGAGAAAACTGAAAAATGGTGG + Intronic
901600033 1:10416484-10416506 CACAGCAACCAGAAGAAAGGTGG - Intronic
902056928 1:13608725-13608747 AAGAGCACACCGAACAAAGGCGG + Intronic
903847529 1:26287378-26287400 CAGACAACAGAGCAGAAAGGTGG + Intronic
904100828 1:28025691-28025713 CAGATAACAAATAAGAATGGTGG + Intronic
904726158 1:32549914-32549936 CAGCCAAAACAGAAGAAAGATGG + Intronic
904757248 1:32774696-32774718 CAGAGGACAAAGGAGAAGGGAGG + Exonic
905351535 1:37350010-37350032 CATAGAACACAGGAGTAAAGGGG + Intergenic
905510218 1:38513420-38513442 CATGGAAGAAAGAAGAAAGGTGG - Intergenic
905749066 1:40445849-40445871 GAGAGCACACTGAACAAAGGAGG - Intergenic
906800805 1:48735422-48735444 CAGAGGAGAAAGAAGAGAGGAGG + Intronic
907241460 1:53083563-53083585 CAGAGAAAACGGAAGACTGGAGG - Intronic
907590204 1:55659458-55659480 CAGAGAAAACAAAAAAAAGTAGG - Intergenic
907665540 1:56431184-56431206 AAGAGAAGAAAGAAGAAAGGAGG + Intergenic
907723045 1:56991611-56991633 CATAGAAGGAAGAAGAAAGGTGG - Intergenic
907800106 1:57756431-57756453 CAGAGAATAGATAAGAAAGTGGG + Intronic
908032417 1:60015594-60015616 CAGAGAACACAGCAAGAAAGTGG - Intronic
908539423 1:65108589-65108611 CAGAGAACAATAAAGAAAGCAGG + Intergenic
909418428 1:75434123-75434145 GTGAGAACACAGAGGAAAGGAGG - Intronic
909428562 1:75557400-75557422 GTGAATACACAGAAGAAAGGTGG + Intronic
909568183 1:77079146-77079168 CAAAGAAGGCAGGAGAAAGGAGG - Intergenic
909625918 1:77715904-77715926 CAAAAACAACAGAAGAAAGGAGG + Intronic
909659064 1:78062372-78062394 CAGAGAACACAGAAGAAGGAAGG - Intronic
909698960 1:78499205-78499227 GAGAGAACAGAGAAGAAAGAGGG - Intronic
910724527 1:90324538-90324560 CAGAGAACTCTGCAGGAAGGGGG + Intergenic
910774100 1:90857774-90857796 CAGAGAACACAGAAATAACAGGG + Intergenic
910855519 1:91691210-91691232 GAGAGAAAACAGAAAAAAGGGGG + Intronic
911327791 1:96489687-96489709 CAGAGAACCCATAAGAAATTAGG + Intergenic
911362988 1:96902107-96902129 GAGAGCACACGGAACAAAGGAGG - Intergenic
911506364 1:98757399-98757421 CTGAGGACACAGCAGGAAGGTGG - Intronic
911559262 1:99383959-99383981 CAGAGAGCACAGAATAAAAGAGG + Intergenic
911734046 1:101317920-101317942 GAGAGAACCCAGAAATAAGGGGG + Intergenic
913256346 1:116957425-116957447 CACAGAACACACAGAAAAGGTGG - Intronic
913363202 1:118005057-118005079 CAGAGCAAACACAAGACAGGAGG - Intronic
913941528 1:125112855-125112877 TAGAGAACAGAGAAAAAAGTAGG + Intergenic
914741846 1:150472172-150472194 CTGATAGCACAGAAGAAAAGGGG + Exonic
915700004 1:157783072-157783094 GAGAGAAGAAAGAAGAAAGGAGG - Intergenic
915794363 1:158712287-158712309 TAGAGAAAACAGAAGAAATTTGG - Intergenic
915800333 1:158784576-158784598 CAGAGACTAGAGAAGAAAAGGGG - Intergenic
915865182 1:159491860-159491882 CAGATAAACCAGAAGACAGGTGG - Intergenic
916684056 1:167128442-167128464 CAGAAAACAGAGAAGAAGGGAGG + Exonic
916873939 1:168948312-168948334 CAGAGAACTCTGAAGACAGCTGG - Intergenic
917307272 1:173639474-173639496 AAGAGAACACAGAAGGAAAATGG + Intronic
917659087 1:177160248-177160270 TGGAGAAAACAGAAGAATGGGGG - Intronic
918079128 1:181192213-181192235 CAGGGAACACAGAAGATGTGAGG - Intergenic
918454021 1:184688506-184688528 CAGGAACCACAGAAGGAAGGTGG + Intergenic
918823167 1:189285664-189285686 CAAAGAACACAGTATAAAAGGGG - Intergenic
919061586 1:192640902-192640924 TTGAAAACACAGAAGAAAGAAGG - Intronic
919267650 1:195292801-195292823 CAGATATCACAGAAGAACAGAGG - Intergenic
919276371 1:195422800-195422822 CAGAGAACACAGAGATAATGTGG + Intergenic
919333050 1:196195429-196195451 GAAAGAAAACAGAAGAAAGAAGG + Intergenic
919348041 1:196411353-196411375 CTAAGAACAAAGAAGAAAGCAGG - Intronic
919611911 1:199755922-199755944 CATATAAAACAGAAAAAAGGGGG + Intergenic
919813075 1:201421152-201421174 CAAAGAACACAGAAGCAAGATGG + Intronic
919984972 1:202667116-202667138 TAGAGAACTGAGAAGTAAGGCGG + Intronic
920049528 1:203154926-203154948 CAGAGAAAAAAGAAGGAAGAGGG - Intronic
920369292 1:205467752-205467774 CAGAGAACACTGAAGTACAGAGG + Intergenic
920683705 1:208092933-208092955 AAGAGAACAAAGAGGGAAGGTGG + Intronic
920776883 1:208947427-208947449 CAGACAACATATAAGAAAGTAGG + Intergenic
920823594 1:209403749-209403771 CAGAGAACACAGAACACTCGAGG + Intergenic
920828024 1:209440249-209440271 CAGAGAAAAGAAAAGACAGGAGG + Intergenic
920852074 1:209634720-209634742 CAGTGAACTCGGGAGAAAGGGGG + Intronic
920906707 1:210176685-210176707 CAGAAATCACAGAGGAAATGGGG - Intergenic
920947335 1:210542028-210542050 AAGAGAAAGCAGAAGGAAGGAGG - Intronic
921308142 1:213817306-213817328 CAGAGGCCAGAGAAGGAAGGCGG + Intergenic
921359783 1:214320040-214320062 CAGAAAAGAAAGAAGGAAGGAGG + Intronic
921364865 1:214364284-214364306 CAGATAAAACAGGAGAAATGAGG - Intronic
921367430 1:214386929-214386951 CAGAGAACACAGAGGAGGTGGGG + Intronic
921392463 1:214630421-214630443 CAGAGAGCACAGGAGACAGCAGG - Intronic
921559059 1:216634982-216635004 GAGAGAGCAAAGAAAAAAGGAGG - Intronic
921597795 1:217073748-217073770 GAGAAAACAAGGAAGAAAGGAGG + Intronic
922236455 1:223726256-223726278 CAGACCCCACAGAAGAAGGGAGG - Intronic
922551174 1:226495707-226495729 TAGAGAACCCAAGAGAAAGGAGG + Intergenic
922565323 1:226597819-226597841 CAGAGATCACAGGAGGAAGTGGG + Intronic
922707575 1:227797316-227797338 AAGAGGACACAGGAGGAAGGTGG + Intergenic
922948719 1:229539602-229539624 AAGAAAACACAGAAGTCAGGTGG + Intronic
922964721 1:229679193-229679215 GAGAAAAGAAAGAAGAAAGGAGG - Intergenic
923028002 1:230221958-230221980 AAAAGAAGACAGAAGTAAGGAGG - Intronic
923312595 1:232749236-232749258 AAGAGCACACGGAACAAAGGAGG - Intergenic
923388523 1:233490254-233490276 CAGAGTTCACAGAAGAAACCTGG - Intergenic
923477654 1:234350207-234350229 CAAAGAAGAAAGAAGAAAGAAGG + Intergenic
923922013 1:238577499-238577521 CAGAGAACACAGAAGCAGCTGGG + Intergenic
924000629 1:239547993-239548015 AAGAGAGCAAAAAAGAAAGGAGG + Intronic
924133458 1:240937233-240937255 GAGAGCACACCGAACAAAGGAGG - Intronic
924529969 1:244885183-244885205 AAGAGAAGAGAGAAGAGAGGGGG - Intergenic
924876563 1:248111310-248111332 AAGAGCACACAGAAAAAAGGAGG - Intergenic
1062840738 10:669299-669321 AAGACAAGACAGAAGCAAGGGGG + Intronic
1063156366 10:3382635-3382657 CCCAGAACACATGAGAAAGGTGG + Intergenic
1063201860 10:3791600-3791622 AAGAGAAAAGAAAAGAAAGGGGG + Intergenic
1063520404 10:6735833-6735855 CAGATAAGCCAGAAGCAAGGTGG - Intergenic
1063986159 10:11505105-11505127 TAGAGATAACAGAAGAAAGGAGG + Intronic
1064529748 10:16296138-16296160 AAAAGAACACAGAAGAGACGTGG - Intergenic
1064704055 10:18052292-18052314 CAGAGAATGCAGAAAAAAAGTGG + Intergenic
1064835884 10:19529523-19529545 CAGAGAAGACAGAAAAAAACAGG + Intronic
1064912916 10:20422757-20422779 CAGAGAACCCAAAAGTAATGCGG - Intergenic
1064935264 10:20672244-20672266 AAGACAGCACAGGAGAAAGGAGG + Intergenic
1064973407 10:21089047-21089069 CAGAGGAGACAGAAAAAGGGAGG + Intronic
1065121127 10:22531309-22531331 GAGAGAGTACAGAAAAAAGGGGG + Intergenic
1065308555 10:24391959-24391981 AAGACAACACAGAAGAAAGTAGG + Intronic
1065846833 10:29751556-29751578 CAGAGTACAGAGAGGAAAAGAGG + Intergenic
1066239778 10:33522362-33522384 AAGAGAACAAACAAGCAAGGTGG + Intergenic
1066292871 10:34029795-34029817 CAGAGAAAACAGAAAATAGCAGG + Intergenic
1066365042 10:34768733-34768755 CAGAGTGCAGAGAAGAAAAGTGG - Intronic
1066466055 10:35651295-35651317 CAGAGAACATAGAATTCAGGGGG + Intergenic
1066556002 10:36613725-36613747 AATAGAAGTCAGAAGAAAGGGGG - Intergenic
1066782238 10:38964398-38964420 TAGAGAACAGAGGAAAAAGGAGG + Intergenic
1066951166 10:42118692-42118714 TAGAGAACAGAGGAAAAAGGAGG - Intergenic
1066954879 10:42156229-42156251 TAGAGAACAGAGGAAAAAGGAGG - Intergenic
1067059911 10:43072983-43073005 CAGAGGGGAAAGAAGAAAGGAGG + Intergenic
1067846252 10:49723981-49724003 CTGAGAAGCCAGCAGAAAGGGGG - Intergenic
1067977488 10:51042624-51042646 CGCGGAACAGAGAAGAAAGGAGG + Intronic
1068041241 10:51826727-51826749 TAAAGAACAAAGGAGAAAGGAGG + Intronic
1068068873 10:52170186-52170208 CTGAGGACAAAGAAGAAAGAAGG + Intronic
1068199974 10:53771390-53771412 AAGAGAAGGCAGAAGACAGGTGG + Intergenic
1068633898 10:59327238-59327260 GAAAGAAGACAGAAGAAATGGGG + Intronic
1068831089 10:61495751-61495773 CAGAGAACAGAGGAGAGATGAGG + Intergenic
1069614639 10:69799271-69799293 CAGGGCTCCCAGAAGAAAGGGGG - Intergenic
1069675106 10:70240731-70240753 GAGAGAAGAGAGAAGAGAGGAGG + Intergenic
1070210410 10:74313309-74313331 CAAAAAAAACAGAAGAAAGATGG - Intronic
1070237154 10:74640467-74640489 CGGAGCACACAGAAGACAAGAGG - Intronic
1070529758 10:77326212-77326234 CAGAGAAAACAGATGAGATGAGG - Intronic
1070652641 10:78249013-78249035 CACAGCACACAGGAGGAAGGAGG - Intergenic
1071017224 10:81012044-81012066 TACAGGACACAGAAGAAATGCGG - Intergenic
1071129195 10:82371782-82371804 CAGAGATCACACAAGGAAAGAGG + Intronic
1071805613 10:89117219-89117241 CAGAGAAGTGAGATGAAAGGAGG + Intergenic
1072183549 10:93012033-93012055 CAGAGAACCAAGAACAAAGGGGG + Intronic
1072794878 10:98347090-98347112 AAGAGCACACCGAACAAAGGAGG + Intergenic
1073112602 10:101071578-101071600 AAGAGGACACAGAAGAAGGAAGG - Intergenic
1073137793 10:101229374-101229396 CAGAGAAGAGAGAAGAGAGAGGG - Exonic
1073685016 10:105742830-105742852 AAGAGAACACACAAGCAAAGAGG + Intergenic
1073696509 10:105875547-105875569 GAGAGAACTCAGAAGCAATGAGG - Intergenic
1074970826 10:118535367-118535389 CAGAATACACAGAAGACAGAAGG - Intergenic
1075090677 10:119442528-119442550 CAGAGCAGACTGAGGAAAGGTGG - Intronic
1075297643 10:121292203-121292225 CAAAGAAAACAAAAAAAAGGGGG - Intergenic
1075775307 10:124980347-124980369 CAAAGACCACTGAAGAAGGGAGG - Intronic
1075855236 10:125624359-125624381 CAGAGACCAGAGAAGAAAGTGGG + Intronic
1075898328 10:126017793-126017815 CAGAGAACAGGGAGCAAAGGTGG + Intronic
1075975447 10:126690059-126690081 CAGAGAACACAGCTGACAGCAGG + Intergenic
1076225085 10:128768138-128768160 TAGAGTACAAAGCAGAAAGGTGG + Intergenic
1076436542 10:130449219-130449241 TAGAGAAAACAGAAAAAAGTTGG - Intergenic
1076565940 10:131399345-131399367 GAGAGTACACCGAACAAAGGAGG + Intergenic
1076654604 10:132015386-132015408 GAGAGTACACCGAACAAAGGAGG + Intergenic
1076829109 10:132985455-132985477 CCGAGGACCCCGAAGAAAGGAGG - Intergenic
1077736930 11:4801157-4801179 CAGAGAACTCAGAAGAAGACAGG - Intronic
1077890295 11:6413436-6413458 CTGAGAACACAGAGGGAAGGGGG - Intronic
1078135352 11:8647578-8647600 CAGAGAACACACAGGGAAAGGGG + Intronic
1078172918 11:8943221-8943243 CATATAACCCAGAAGAATGGGGG - Intergenic
1078192522 11:9103737-9103759 CAGTGACCACAGAAGAAAGCGGG - Intronic
1078366987 11:10715095-10715117 CAGAGAGCACAGAGAAAAGCAGG + Intergenic
1078434602 11:11314066-11314088 CAGAGAGCACAGAGCCAAGGCGG + Intronic
1078441263 11:11370830-11370852 CAGAGAACACAAGCGAATGGAGG + Intronic
1078626355 11:12962379-12962401 AAGAGAAGACAGAAGGCAGGAGG + Intergenic
1079093735 11:17497787-17497809 CAGAGAACCCAGGATGAAGGAGG - Intronic
1079659501 11:23021006-23021028 CAGACAACCCAGAAGGAAGAAGG - Intergenic
1079923555 11:26462481-26462503 CAGAGAACACTGAAAAATGATGG - Intronic
1080186521 11:29493846-29493868 CAAAGAAGACAGAAGGAAGAGGG - Intergenic
1080306969 11:30846989-30847011 AAGAGCACACTGAACAAAGGAGG - Intronic
1080450534 11:32375289-32375311 CAGATACCACATAAGAAAGAGGG + Intergenic
1083059097 11:59850919-59850941 AAGAAAACACAGGAGAAATGAGG + Intergenic
1083687765 11:64387241-64387263 CAAAGAACACAAATGAAAGATGG + Intergenic
1085402884 11:76245004-76245026 GTGAGAACACAGCAAAAAGGTGG + Intergenic
1085567147 11:77524550-77524572 CAGAGAACACAGAAGAGGGCAGG - Intronic
1085670526 11:78460081-78460103 CTGAAGACACAGAAGAAGGGTGG + Intronic
1085741449 11:79081179-79081201 CTGAGAAGACAGAGGAAAAGAGG - Intronic
1085827379 11:79862218-79862240 AACAGAAAACAGAAGAAAGCAGG + Intergenic
1085869998 11:80338338-80338360 TAGGGAAGAAAGAAGAAAGGTGG - Intergenic
1086000757 11:81983383-81983405 CAGAGAAGACAGAAAAAAGGAGG - Intergenic
1086776958 11:90848586-90848608 AAGAGAAAAGAAAAGAAAGGAGG + Intergenic
1087195138 11:95297662-95297684 TAGAGATCACACAAGAAATGAGG + Intergenic
1087195811 11:95303292-95303314 CAGTGAGCACAGAAGACAGGAGG + Intergenic
1087204714 11:95381975-95381997 CAGAGAACCCAGAGAAACGGTGG + Intergenic
1087344423 11:96952625-96952647 CAGAGAAAATATAAGAAATGCGG - Intergenic
1088319486 11:108540784-108540806 CAGAGATCAGAGGAGAAGGGAGG - Intronic
1088322447 11:108568022-108568044 CAGAATACACTGAAGACAGGGGG + Intronic
1088545397 11:110953725-110953747 CTAAGAACAAAGAACAAAGGAGG - Intergenic
1088736610 11:112732812-112732834 CAGAGAGCAAAGAAGAGAAGTGG - Intergenic
1089029183 11:115305647-115305669 CAGAAAACACAGAGGGGAGGAGG - Intronic
1090035718 11:123247887-123247909 AAGAAAACAGAGAAGAGAGGAGG + Intergenic
1090134392 11:124181981-124182003 TAGAGAAAACAAAAGAAAAGAGG - Intergenic
1090566306 11:127995632-127995654 CAGAGAACAGAGAAGATGAGTGG - Intergenic
1090703242 11:129314820-129314842 CAAAGAAAGCAAAAGAAAGGAGG - Intergenic
1090879911 11:130824413-130824435 GAGAGGACACAGAAGAAGAGAGG - Intergenic
1090931936 11:131305478-131305500 CAGAGAACACGGTGGAATGGTGG + Intergenic
1091076423 11:132622306-132622328 CAAAGACAACTGAAGAAAGGGGG + Intronic
1092379387 12:7982782-7982804 TAGAGATGACAGAAGAAAAGTGG + Intergenic
1092485009 12:8895474-8895496 CAGAGAACCCAAAAGAAAAATGG - Intergenic
1092601604 12:10072182-10072204 GAGAGAACACAAAAGAGAAGGGG - Intronic
1092645530 12:10567396-10567418 CAAAGAACACAGGAGTCAGGAGG - Intergenic
1093038806 12:14356506-14356528 GAGAGAAAAAAAAAGAAAGGAGG - Intergenic
1093428151 12:19052606-19052628 CTTAAAACATAGAAGAAAGGAGG + Intergenic
1094097381 12:26722579-26722601 AGGAGAACAAAGAATAAAGGTGG - Intronic
1094210576 12:27885756-27885778 CTGGGAACAAAGAAGAAGGGTGG - Intergenic
1094617121 12:32046084-32046106 CCAAGAACACAAAAGAATGGGGG + Intergenic
1095552956 12:43466076-43466098 CAGAGAAACCTGAAGGAAGGTGG + Intronic
1095750643 12:45706946-45706968 CAAAGAAGGCAGGAGAAAGGTGG - Intergenic
1095912052 12:47437738-47437760 CAAAGCAAACAGAAGGAAGGAGG + Intergenic
1096179888 12:49544804-49544826 TAGAGATGACAGAAGAAATGTGG - Intronic
1096368016 12:51044989-51045011 CAGAGAAGATAGAAGGAAGCTGG + Intergenic
1096395481 12:51262927-51262949 AAGAGAAGGCAGAAGAAAGGGGG - Intronic
1096562901 12:52449725-52449747 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096565052 12:52471388-52471410 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096567064 12:52490825-52490847 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096638758 12:52977648-52977670 GAGAGAAGAGAGAAGAGAGGGGG - Intergenic
1097239760 12:57567253-57567275 CAGAGGACACAGAACACAAGTGG - Intronic
1097548051 12:61029398-61029420 AAGAGAACGAAGAAGAAAGAAGG - Intergenic
1098150948 12:67545604-67545626 CACACAACACAGAAGGAGGGAGG + Intergenic
1098579901 12:72087386-72087408 CTGAAGACACAGAAGAAAGATGG + Intronic
1098738873 12:74144892-74144914 CAGTTAAAACAGAAGAAAGGAGG - Intergenic
1098895704 12:76057814-76057836 AAGAAAAAACAGAAGAGAGGTGG + Intronic
1099027224 12:77480002-77480024 CAAAGAAAGCAGAAGAAAGCAGG - Intergenic
1099274519 12:80558095-80558117 AAGAAAAGAAAGAAGAAAGGAGG - Intronic
1099596326 12:84671465-84671487 CAGAGACTACAGAAGGTAGGAGG + Intergenic
1100040510 12:90311821-90311843 CAGAGAATAAAGAAGACAGAGGG + Intergenic
1100482921 12:94996517-94996539 AAGGGAGAACAGAAGAAAGGAGG + Intronic
1100877224 12:98975102-98975124 AAGAGGAAACAGAAGAAAGTAGG - Intronic
1101145728 12:101838867-101838889 CAGAGCAAACAGAATAAGGGGGG - Intergenic
1101383480 12:104235147-104235169 GAGAGCACACTGAACAAAGGAGG + Intronic
1101612995 12:106309205-106309227 GAGAGAAGACAGAAGAAAAGGGG - Intronic
1101802636 12:108035570-108035592 CAAAGCACACAGAAGACAGGAGG + Intergenic
1102219521 12:111185171-111185193 AGAAGAACACAGAATAAAGGTGG + Intronic
1102831029 12:115999851-115999873 CAGAGAACACACAAAAAAGCAGG + Intronic
1103214909 12:119194511-119194533 CACAGGGGACAGAAGAAAGGGGG - Exonic
1103677246 12:122665551-122665573 AAGAGAAAAGAGAAGAAAAGAGG - Intergenic
1103796402 12:123506173-123506195 CAGAGGCCACAGAGGAAAGGAGG + Intronic
1104124483 12:125833209-125833231 CAGATGACAAAGAAGAAAGCTGG - Intergenic
1104352901 12:128060097-128060119 CAGAGAAAACAAAACAGAGGAGG - Intergenic
1104518682 12:129452698-129452720 AAGAAAAGAAAGAAGAAAGGAGG + Intronic
1105748424 13:23399270-23399292 TCGAGAACAAAGAACAAAGGAGG - Intronic
1106610613 13:31276081-31276103 CTGATCACACAGATGAAAGGGGG - Intronic
1106742274 13:32657385-32657407 AACAGAAAACAGAAGAAAGCAGG - Intronic
1106743668 13:32676030-32676052 CAGAGAACACAGTTTAAATGTGG - Intronic
1106910787 13:34461457-34461479 CAGAGTACACTTGAGAAAGGAGG - Intergenic
1107036351 13:35906530-35906552 CAGGCAACAGAGATGAAAGGAGG + Intronic
1107527990 13:41252448-41252470 AGGAGAAGACAGTAGAAAGGAGG - Intronic
1108108854 13:47045841-47045863 TAGAGAACAAAAAAGAAATGAGG + Intergenic
1108209533 13:48124405-48124427 CAGAGGAATCAGAAGAAAGGTGG - Intergenic
1108304086 13:49113342-49113364 AAGAGAATACAAAAGAAAGGGGG - Intronic
1108380207 13:49847720-49847742 AAGAGACCCCAGAAGCAAGGAGG - Intergenic
1108408976 13:50129259-50129281 CAGAGAAAAAAAAAAAAAGGTGG - Intronic
1108432763 13:50371031-50371053 CAGAGCACACAGAGGGGAGGAGG + Intronic
1109404211 13:61876460-61876482 TAGAGAACAAAGGAGAGAGGAGG - Intergenic
1109478818 13:62920049-62920071 AATAGCACACAGAAGACAGGTGG - Intergenic
1109838717 13:67893768-67893790 AAAAGAACAATGAAGAAAGGTGG + Intergenic
1111111663 13:83719234-83719256 CAGAGCACAAAGAATAAAGTAGG + Intergenic
1111224272 13:85249036-85249058 CAGAGAGATCAGAGGAAAGGAGG + Intergenic
1111286895 13:86105818-86105840 CACAGAAAACAGAAAAAAGCAGG - Intergenic
1111538171 13:89631360-89631382 CAGAAAATACAGATGAAAGAAGG - Intergenic
1111875009 13:93882057-93882079 AAGAGAAAAGAAAAGAAAGGAGG - Intronic
1112264804 13:97913590-97913612 GAGAGGACACAGGAGAAAGATGG - Intergenic
1113042888 13:106123800-106123822 GAGAAAACACACAAGGAAGGTGG + Intergenic
1113462409 13:110491385-110491407 CGGAGACCCCAGAACAAAGGCGG + Intronic
1113770495 13:112905202-112905224 AAGAGCACACCGAACAAAGGAGG + Intronic
1114005593 14:18309887-18309909 TAGAGAACATGGAAGAAAGCTGG - Intergenic
1114080774 14:19200273-19200295 CAGAGGACACAGAAGGAGGGAGG + Intergenic
1114241289 14:20870805-20870827 AAGAGAGAAAAGAAGAAAGGAGG + Intergenic
1114332679 14:21652930-21652952 AAATGAACACAGAAGAAATGGGG - Intergenic
1114367701 14:22047710-22047732 GAGGAAAGACAGAAGAAAGGAGG - Intergenic
1114596134 14:23913682-23913704 AAGAGAACAAAAAAGAAAGAGGG + Intergenic
1114794433 14:25696514-25696536 CAGAGGAGACAGAAATAAGGGGG + Intergenic
1114928299 14:27433548-27433570 CAGAGAATACAGAAAAAAAAGGG + Intergenic
1115084176 14:29493319-29493341 AAGAGATCAGAGAAGAAAAGAGG + Intergenic
1115131532 14:30057762-30057784 CTGAGAAAACAGAAGAAAGGGGG + Intronic
1115540923 14:34420771-34420793 CAGAGCACACCGAACAAAAGAGG + Intronic
1115790968 14:36877732-36877754 CACAGAAAAAAGAAGAAAAGAGG + Intronic
1116047296 14:39760309-39760331 CAAAGAGGAGAGAAGAAAGGAGG + Intergenic
1116209567 14:41917439-41917461 CAGAGAAGACAGAGAAAAGGGGG - Intergenic
1116710080 14:48357289-48357311 GTGAGAACACAGCAAAAAGGTGG - Intergenic
1117106767 14:52405427-52405449 CTAAGAACAAAGAAGAAGGGTGG + Intergenic
1117339431 14:54780965-54780987 AAGAGAACTAAGAAGAAAGGGGG - Intronic
1117481375 14:56148666-56148688 CAGAGAACACAGAAGAAAGGAGG - Intronic
1118321716 14:64757362-64757384 AAGAGGAAACAGAAGAAAGGTGG - Intronic
1118652926 14:67916976-67916998 TACTGAATACAGAAGAAAGGAGG + Intronic
1119133468 14:72195513-72195535 CAGAGTAGAGAGAAGAAAAGAGG + Intronic
1119517592 14:75260401-75260423 CAGAGGAGATAGAGGAAAGGAGG - Intronic
1119586759 14:75842960-75842982 CATAGCAAAAAGAAGAAAGGTGG + Intronic
1120129990 14:80795322-80795344 CAGATAACACAGAAGGAAGAGGG - Intronic
1120260462 14:82178166-82178188 CAGAGGACAAAGAAGAAATGAGG - Intergenic
1121216527 14:92252815-92252837 GAGAGAAAACAGAAGAAGGAGGG + Intergenic
1122538607 14:102483745-102483767 CAGAGCAGACAGAAAACAGGAGG - Intronic
1122917935 14:104867354-104867376 CAGGGAACACAGAGGCAGGGCGG - Intronic
1122993852 14:105251952-105251974 CACACAACACAGAACAAAAGTGG + Intronic
1123538174 15:21260887-21260909 CAGAGATTGCAGGAGAAAGGGGG + Intergenic
1123967957 15:25477808-25477830 CAGAGAACTGAGGAGAAAGGTGG - Intergenic
1124797048 15:32791989-32792011 CAGAGAATAGAGCAGAAAAGAGG + Intronic
1124850941 15:33338446-33338468 AAGAGAACACAGACAAAACGGGG + Intronic
1125245836 15:37638045-37638067 CAGAGCAAACAGAAGGGAGGAGG + Intergenic
1126036502 15:44551061-44551083 CAGGGAAAACAGAATAAAGTGGG - Intronic
1126522373 15:49610612-49610634 TATAGAAAACAGAAAAAAGGTGG - Intronic
1126615351 15:50573385-50573407 CAGAGAACACTGAAGAACTGAGG + Intronic
1127409600 15:58692610-58692632 CAGAGTACTTAGAAGAGAGGTGG - Intronic
1128029490 15:64467245-64467267 CAGAGAACACAATAAAAAGAAGG - Intronic
1128221378 15:65971046-65971068 CTGAGAAGACATAAGGAAGGAGG + Intronic
1128955686 15:71940939-71940961 AAGAAGAGACAGAAGAAAGGAGG + Intronic
1130106507 15:80932497-80932519 CAGAGAAGGCAGAAGAGGGGCGG + Intronic
1130634982 15:85609824-85609846 CAGAGAAAATGGAAGAGAGGAGG - Intronic
1130662832 15:85844051-85844073 CAGAGAAGACAGCATAAGGGAGG + Intergenic
1131308118 15:91263850-91263872 GAGAGAAGGCAGAGGAAAGGAGG - Intronic
1131353202 15:91720363-91720385 AGGAGAAGACAGAAGAAAGTGGG + Intergenic
1133064248 16:3194911-3194933 CAGAAGTCACAGAAGAAGGGCGG - Intergenic
1133234069 16:4379568-4379590 CAGGGCAGACAGAAGAAAGCAGG - Intronic
1133813326 16:9177904-9177926 AAGAGGACACAGCAGGAAGGTGG - Intergenic
1133826363 16:9281788-9281810 CAGATAGAACAGAAGAGAGGAGG - Intergenic
1133873242 16:9709265-9709287 CTGAGAACCCAGAAGGCAGGAGG - Intergenic
1134140125 16:11711212-11711234 CAGAGAAAACAGAGTAAGGGTGG + Intronic
1134369609 16:13610835-13610857 CAGAGAACAGAGAACAGAGGAGG - Intergenic
1135200192 16:20430644-20430666 TAGGGAACAAAGAAGAAGGGAGG + Intronic
1135218498 16:20592965-20592987 TAGGGAACAAAGAAGAAGGGAGG - Intergenic
1135271737 16:21075601-21075623 CAGAGAAGACACATCAAAGGAGG + Intronic
1135715201 16:24758733-24758755 CAGAGAACAAGAAATAAAGGAGG - Intronic
1136697028 16:32091267-32091289 TAGAGAACAGAGAAAAAAGTAGG - Intergenic
1136797527 16:33034557-33034579 TAGAGAACAGAGAAAAAAGTAGG - Intergenic
1137084923 16:36107968-36107990 TAGAGAACAGAGAAAAAAGTAGG - Intergenic
1137408774 16:48210484-48210506 TAGATAACAGAGAAGAAAAGAGG + Intronic
1137483596 16:48873153-48873175 CAGAGAAAACATCAGAAAGGAGG + Intergenic
1137613961 16:49836087-49836109 GGGAAAACACAGTAGAAAGGAGG + Intronic
1138139302 16:54553738-54553760 CTGAGAAGACAGAAGACAAGAGG - Intergenic
1138465175 16:57185240-57185262 CAGTCCACACAGAGGAAAGGGGG - Intronic
1138533887 16:57649559-57649581 GAGGGAACACAGAAAAAAGGGGG - Intronic
1138613783 16:58148206-58148228 GAGAGGACACAGAGAAAAGGTGG - Intergenic
1139089839 16:63632015-63632037 CAGAGCAAAGACAAGAAAGGAGG + Intergenic
1140363597 16:74364882-74364904 CAGAGAACAAAGAAGATGGGGGG + Intergenic
1140423617 16:74842020-74842042 AAGAGAACACAGATGAAACAAGG + Intergenic
1140427815 16:74875439-74875461 CAGATGACACAGAGAAAAGGGGG - Intronic
1141010312 16:80390969-80390991 CAGAGAGCTTAGAACAAAGGTGG + Intergenic
1141057848 16:80835138-80835160 CAGAGGACACAGTTGAAATGAGG + Intergenic
1141286346 16:82676010-82676032 CAAAGGACAGGGAAGAAAGGAGG + Intronic
1141433006 16:83980610-83980632 CCGAGAAAACAGAACAAGGGTGG + Intronic
1141670681 16:85490211-85490233 CAGGGAACACAGAAAACATGAGG - Intergenic
1141685339 16:85566824-85566846 CAGGGAACATAAAAGAAGGGAGG + Intergenic
1141711109 16:85699396-85699418 CTGAGAAGCCAGAAGGAAGGGGG + Intronic
1141747759 16:85937459-85937481 CTGTGAACAAGGAAGAAAGGAGG + Intergenic
1141853878 16:86667763-86667785 AAGAGAACTTAGAAGAAAAGAGG - Intergenic
1141874298 16:86811574-86811596 GTGAGAACAAGGAAGAAAGGGGG + Intergenic
1142033667 16:87850943-87850965 CAGAGAACACAGGTGCAAAGGGG + Intronic
1142566538 17:843923-843945 AAAAGAACAAGGAAGAAAGGAGG + Intronic
1142607610 17:1090766-1090788 CAGAGAACAGGGCAGGAAGGAGG + Intronic
1143259669 17:5588710-5588732 AAGAGCACACTGAACAAAGGAGG + Intronic
1143456156 17:7069450-7069472 CAGAGAAGACAGAAATAATGGGG - Intergenic
1143796319 17:9339676-9339698 CAGAGTACACAGCAGGAATGAGG - Intronic
1143955505 17:10665053-10665075 TAGAAAATATAGAAGAAAGGTGG + Intergenic
1144046908 17:11462174-11462196 CAGAGAGGACAGAAGCAAGAGGG - Intronic
1144246640 17:13372658-13372680 CAGAGCACAATGAAGAAAGAAGG + Intergenic
1144504899 17:15821594-15821616 CAGAGAACACAGAGGCACAGAGG + Intergenic
1145169072 17:20639477-20639499 CAGAGAACACAGAGGCACAGAGG + Intergenic
1146479324 17:33192028-33192050 GAGAGAAGAAAGAGGAAAGGAGG - Intronic
1146960513 17:36971920-36971942 TAGAAAACAAAGAAGAAAGCTGG - Intronic
1147156977 17:38548933-38548955 CAGAGAACATGGAAGGAAAGAGG - Intronic
1147728617 17:42582439-42582461 CAGGGGACATAGAAGAGAGGGGG - Intronic
1148063281 17:44851070-44851092 CAGAGGCCACAGAAGGAAGCAGG + Exonic
1148552717 17:48560112-48560134 CAGAGAAGGCAGAGGAAGGGAGG + Intronic
1148568493 17:48647593-48647615 CACAGGGAACAGAAGAAAGGAGG - Intergenic
1149268545 17:54953394-54953416 CAGGTTACACAGAAGAAGGGGGG - Intronic
1150198860 17:63332272-63332294 AAGAAAAAACAGAAGAGAGGTGG - Intronic
1150444741 17:65220249-65220271 CAAAGAACAGAGAAGATAGATGG - Intronic
1150522529 17:65884058-65884080 CACAGAACACAGATGAGAGACGG + Intronic
1151923422 17:77174851-77174873 AAGAGCACACTGAACAAAGGAGG + Intronic
1152551652 17:81033375-81033397 CAGGGAACACAGCAGGAAGCTGG + Intergenic
1152851170 17:82637006-82637028 CAGAGAACAAAGGAGACCGGGGG - Intronic
1152913031 17:83016450-83016472 CAGAGAGAAGAGAATAAAGGAGG + Intronic
1153370174 18:4306486-4306508 AAGAAAATAAAGAAGAAAGGAGG + Intronic
1153803237 18:8689967-8689989 CTGAGAAGACTGATGAAAGGGGG - Intergenic
1153857372 18:9163360-9163382 CAGAGAACTCAGAAATAAGATGG - Intronic
1154350299 18:13577535-13577557 CAGAGAAAACTTAAGAAATGGGG + Intronic
1154531834 18:15353987-15354009 TAGAGAACATGGAAGAAAGCTGG + Intergenic
1154931636 18:21003279-21003301 CAAAGAACACAAAAGGGAGGAGG + Intronic
1155168163 18:23247763-23247785 AAGAGAGCACAGCAGACAGGAGG + Intronic
1155783697 18:29873161-29873183 GAGAGCACACTGAAGTAAGGAGG - Intergenic
1155914399 18:31541837-31541859 CAGAGAACTCAGAATAACAGTGG + Intronic
1156233690 18:35180311-35180333 AAGAGATCACAAAAGAAAGAAGG - Intergenic
1156550477 18:38011143-38011165 CAAAGAAGACAGAAGGAGGGAGG + Intergenic
1156632207 18:38983831-38983853 ATGAGAACACAGAAAGAAGGTGG + Intergenic
1156987498 18:43365822-43365844 AAGAGAACAAAGAAAAAAGAAGG + Intergenic
1157079595 18:44508433-44508455 TACAAAACCCAGAAGAAAGGTGG + Intergenic
1157348020 18:46858097-46858119 CAGAGTACAGAGAAAAAAGGCGG + Intronic
1159048642 18:63395818-63395840 CAGACAAAACAGAACACAGGAGG + Intronic
1159816312 18:73078155-73078177 CAGAGCACACGGAACAAAGAAGG - Intergenic
1159817295 18:73091164-73091186 CAGAGAATAAAGAAGAAAAAAGG - Intergenic
1159941868 18:74414481-74414503 AAGAGAAGACAGGAGAGAGGCGG + Intergenic
1160064817 18:75564837-75564859 AAGAGAACACAGAAGAAACAAGG - Intergenic
1160469961 18:79121856-79121878 TAGAGAAGACAGAATAAAGAGGG - Intronic
1160495453 18:79371738-79371760 CAGGGGACACAGAAGACAGCAGG - Intronic
1160766689 19:811920-811942 AAGAGCACAGAGAAGACAGGAGG - Exonic
1161719707 19:5896046-5896068 CAAGGCACACAGAAGGAAGGCGG + Intronic
1161923102 19:7281146-7281168 GACAGGACACAGAAGACAGGAGG + Intronic
1162082247 19:8225171-8225193 TAGAGAAAACAGCAGAGAGGAGG + Intronic
1162613047 19:11771172-11771194 AAGCTAACTCAGAAGAAAGGGGG + Intronic
1163057139 19:14728835-14728857 AAGAGCACAGAGAACAAAGGAGG + Intronic
1163560424 19:18016178-18016200 AAGAGAAAAGAAAAGAAAGGGGG + Intergenic
1163815226 19:19460938-19460960 CAGAGCACACAGAGGGACGGGGG - Intronic
1164147730 19:22522523-22522545 AAGAGAACTCTGAATAAAGGAGG + Intronic
1164737367 19:30551756-30551778 AAGAGGACACAGAAGAAATGGGG - Intronic
1164752293 19:30665857-30665879 CAGAGGACTGAGAGGAAAGGAGG + Intronic
1164801824 19:31083423-31083445 CAGAGAACCCTAAAGAAAGCTGG - Intergenic
1164923901 19:32110752-32110774 CAGAGAAATCACAAGACAGGTGG + Intergenic
1165465489 19:35972284-35972306 CAGTGAACGCAGGAGAAATGTGG + Intergenic
1166493839 19:43283805-43283827 CAGTGAACACAGAAGAAATTTGG - Intergenic
1166776743 19:45317759-45317781 GAGAGATCACAGGAGAAATGGGG - Intronic
1167430256 19:49450073-49450095 GAGAAAACAAAGAAGAGAGGGGG - Intronic
1167684375 19:50946915-50946937 CAGGGCACAGAGAAGAAATGGGG + Intronic
1168588771 19:57615585-57615607 AAGAGCACACTGAACAAAGGAGG + Intronic
1168600654 19:57715573-57715595 AAGATAACACAGAGGAAATGGGG - Intronic
1202669096 1_KI270709v1_random:33577-33599 TAGAGAACAGAGAAAAAAGTAGG + Intergenic
925530283 2:4851859-4851881 CAGAGAACATAGAATAAGCGTGG + Intergenic
925663883 2:6232306-6232328 CAGAGAGCACAGAGGAAAGGAGG - Intergenic
926188897 2:10712557-10712579 CAGAGAGCACAGATGAAGGGCGG + Intergenic
926542338 2:14196921-14196943 AAGAGGACAGAGAGGAAAGGAGG - Intergenic
926649754 2:15329856-15329878 CAGAGATAACATAAGCAAGGTGG - Intronic
926651948 2:15356394-15356416 GTGAGAACCCAGAAGAAAGGCGG - Exonic
926702837 2:15815308-15815330 CTGAGGAAACAGAAGGAAGGAGG - Intergenic
927310940 2:21630524-21630546 CAGAGAACACAGAGGCAATCAGG + Intergenic
928070348 2:28208895-28208917 CAAGGAACAAAGAAGAAAGACGG - Intronic
928254152 2:29707430-29707452 CAGGGAAAACAGAACAAGGGAGG + Intronic
928739033 2:34327971-34327993 TAGAAAACACTGTAGAAAGGAGG + Intergenic
929072206 2:38043575-38043597 CAGAGAAGGCAGAAGAAGAGGGG - Intronic
929138697 2:38648689-38648711 CAGAGCACACAGAAAACAGGTGG + Intergenic
929861260 2:45679790-45679812 GAGGGAACACAGAAGAAGGAAGG - Intronic
931210199 2:60186476-60186498 GTGAGGACACAGAAGAAAGGTGG - Intergenic
931409472 2:62015208-62015230 CAGAGAAAAAAGTAGAAAAGAGG - Intronic
931631081 2:64300120-64300142 AAGACAACACAGTAGAAAGAAGG + Intergenic
932406986 2:71519961-71519983 CAGAAAAGAAAGAGGAAAGGAGG - Intronic
932542038 2:72665016-72665038 CTGAGAACACTGAAGAGGGGTGG + Intronic
932572417 2:72945107-72945129 GAGAGAACAGAGAGGAAAAGTGG + Intronic
934257242 2:91436655-91436677 TAGAGAACAGAGAAAAAAGTAGG + Intergenic
935062856 2:99623338-99623360 GACAGACCATAGAAGAAAGGAGG - Intronic
936099566 2:109563364-109563386 CAGAGTAAACAAAAGAAAGGGGG - Intronic
936376547 2:111946065-111946087 CAGGGAGCACAGATGGAAGGAGG + Intronic
936997570 2:118431420-118431442 CAGAGTACAGAAAAGAGAGGGGG + Intergenic
937240198 2:120455762-120455784 AAAAGAACACAGGAGACAGGAGG + Intergenic
938045278 2:128113581-128113603 AAGAGAAAACAGAAGAAAAAAGG - Intronic
938322607 2:130375009-130375031 CAGAGAACAGGAAGGAAAGGCGG - Exonic
938530931 2:132185226-132185248 TAGAGAACATGGAAGAAAGCTGG + Intronic
939469403 2:142600480-142600502 AAAAGATCACAGAAGAAAGAAGG - Intergenic
939956326 2:148530446-148530468 CAGAGGACACAGCAAGAAGGTGG + Intergenic
940101303 2:150042331-150042353 CAGAGAAACCAGAAGAGAAGTGG + Intergenic
940166441 2:150778919-150778941 AGGAGAACACAGAATAAAGGAGG + Intergenic
940212606 2:151271062-151271084 TATGGAACACAGAGGAAAGGAGG + Intronic
940289631 2:152065980-152066002 TAGAAAACAAAGAAGAAAAGTGG + Intronic
940761238 2:157741736-157741758 AAGAGAACAGAGAAGACAGTGGG + Intronic
941365909 2:164611287-164611309 AAGCTAACACAGAAGAAAGGAGG + Intronic
941999669 2:171633454-171633476 CATAGAACCCAGAAGAAATCTGG + Intergenic
942494663 2:176527121-176527143 CAGAGAAAAGAGGAAAAAGGAGG - Intergenic
942579251 2:177398879-177398901 CCAAGATCAGAGAAGAAAGGAGG + Intronic
942739065 2:179152888-179152910 CAAAGAAAATAGAAGAAAGGAGG + Intronic
943204905 2:184882109-184882131 AAGAGAAAACAGAAAAAAGCAGG + Intronic
943600979 2:189920660-189920682 CACAAGACACAGAAGAAAGTGGG - Intronic
943754551 2:191544455-191544477 AAAAGAACAAAGAAGAAATGAGG - Intergenic
943976915 2:194493655-194493677 CAGAGAAAAGAGAAGGAAGCTGG + Intergenic
944078931 2:195763201-195763223 CAGTGAAAACAGTAGTAAGGTGG + Intronic
944931152 2:204521010-204521032 CATAGAGCACAGAAGCATGGAGG + Intergenic
945225817 2:207530296-207530318 CAGCGAACAAAGAATAATGGCGG + Intronic
945515043 2:210752919-210752941 CAGAGGACCCACAGGAAAGGAGG - Intergenic
945698144 2:213134960-213134982 TAGAGAGCATAGAAGAAAGCTGG - Intronic
945782300 2:214190756-214190778 GAGAGGACACAGAAAGAAGGTGG + Intronic
945965751 2:216184881-216184903 CAGGGCATACAGAAGAAGGGAGG - Intronic
946056091 2:216903187-216903209 CAGAGGACTCAGAAGAAGGCAGG - Intergenic
946099169 2:217304114-217304136 CATAAAACACAGAAGAGAGGTGG - Intronic
946261336 2:218493779-218493801 CAGGCAACCCAGAAGAAAGCAGG - Intronic
946524856 2:220507435-220507457 TAGAGAACACAGATAAAAGTAGG + Intergenic
946617565 2:221526500-221526522 CTGAGCACACAGGAGAAAGGTGG - Intronic
946718797 2:222582230-222582252 CAGAGAAGTCAAAAGAAAGGAGG + Intronic
947575325 2:231269279-231269301 GAGAGAACACAGAAAACAGAGGG - Intronic
947636360 2:231682518-231682540 CAGAGGACCCAGAAGAGAGGTGG - Intergenic
947871001 2:233437971-233437993 AAGAGAAGACAGCAGAAAGGTGG + Intronic
947922677 2:233891900-233891922 CAGATAACACAAAAGAAAAATGG + Intergenic
948066630 2:235086009-235086031 CAGAGAGCACAGGAGAGATGGGG + Intergenic
948719957 2:239893227-239893249 CAGAGAACACAGTAGAGAACTGG + Intronic
1169648657 20:7842659-7842681 CTTAGAAGACAGAAGAAAGAGGG - Intergenic
1170026575 20:11895102-11895124 CACAAAGCAAAGAAGAAAGGAGG - Intronic
1170271919 20:14537064-14537086 AACAGAAAACAGAAGGAAGGGGG - Intronic
1170505841 20:17024959-17024981 CAGAGAAAGCAGAAGAAGGTGGG + Intergenic
1170987519 20:21272131-21272153 AAGTGACCACAGAGGAAAGGAGG - Intergenic
1171004765 20:21453663-21453685 CAGAGAAGACAGCAGGAAAGAGG + Intergenic
1171239953 20:23558494-23558516 AACAGAAATCAGAAGAAAGGAGG - Intergenic
1171293465 20:23995751-23995773 CAAAGAAAACAGAAGCATGGAGG - Intergenic
1172351499 20:34246245-34246267 AAGAAAAAACAGAAGAGAGGTGG - Intronic
1172452586 20:35038028-35038050 CAGAGAAAAAAGCAGAATGGTGG + Intronic
1172706075 20:36883000-36883022 ACGAGAACACAGAAGAAATGAGG - Intronic
1172782913 20:37447783-37447805 CAGAGGAAACAGGAGAAGGGTGG - Intergenic
1172839536 20:37893904-37893926 CAGAGAGGAAAGAAGGAAGGAGG - Intergenic
1172974507 20:38895952-38895974 GAGGGAAGAAAGAAGAAAGGAGG - Intronic
1173131233 20:40395616-40395638 GAGAGAAAACAGAAGATTGGAGG + Intergenic
1173205660 20:40991221-40991243 CAGACAACAAAGAAGAAAAATGG - Intergenic
1173428670 20:42966387-42966409 GAGGGAACACAGAGGAAAGAGGG - Intronic
1175196501 20:57247286-57247308 CAAAGAAGACAGAAGAAATTGGG - Intronic
1176193324 20:63824626-63824648 CAGAGCACCCAGAAGAACGGGGG - Intronic
1176653463 21:9570408-9570430 CAGAGCAGACAGAAGGCAGGAGG - Intergenic
1176765527 21:13014186-13014208 TAGAGAACATGGAAGAAAGCTGG - Intergenic
1176970013 21:15254103-15254125 CAGGGAAAACAGAGGAAAGGAGG + Intergenic
1177965842 21:27725399-27725421 CATAGGACAGAGAGGAAAGGTGG - Intergenic
1178579775 21:33828622-33828644 CAGAAAAAAAAGAAGAAAGAGGG - Intronic
1179353433 21:40635160-40635182 CAGACAAGGCAGAAGAAAGAAGG + Intronic
1179598146 21:42457054-42457076 AAGAGAAGACAGCAGAGAGGGGG + Intergenic
1179669294 21:42934584-42934606 CAGCTAAGACAGAAGAAAGATGG + Intergenic
1179922372 21:44514074-44514096 CAGAGAAGACAGAAGTCATGGGG + Intronic
1180246210 21:46549310-46549332 AAGGCAACACAGAAAAAAGGAGG + Intronic
1180430102 22:15240673-15240695 TAGAGAACATGGAAGAAAGCTGG - Intergenic
1180499999 22:15922412-15922434 CAGAGGACACAGAAGGAGGGAGG - Intergenic
1180824521 22:18853467-18853489 CAAAGAAAACAGAAGCATGGAGG - Intronic
1181124943 22:20696622-20696644 CAAAGAAAACAGAAGCATGGAGG - Intergenic
1181188214 22:21121081-21121103 CAAAGAAAACAGAAGCATGGAGG + Intergenic
1181210982 22:21289412-21289434 CAAAGAAAACAGAAGCATGGAGG - Intergenic
1181279538 22:21709265-21709287 CAGAAAACACCGAGGAAATGGGG + Intronic
1181398518 22:22637476-22637498 CAAAGAAAACAGAAGCATGGAGG + Intergenic
1181650897 22:24258584-24258606 CAAAGAAAACAGAAGCATGGAGG - Intergenic
1181706484 22:24652155-24652177 CAAAGAAAACAGAAGCATGGAGG + Intergenic
1182059937 22:27389559-27389581 AAGAGTGCACAGAAGAAAGGAGG + Intergenic
1183008543 22:34925289-34925311 CTTATAACCCAGAAGAAAGGAGG + Intergenic
1183919397 22:41152568-41152590 CAGGGAACCCTGAAGAAATGAGG - Intronic
1184001164 22:41674670-41674692 CAGAGCAGACAGAAGCAGGGTGG - Exonic
1203215964 22_KI270731v1_random:6018-6040 CAAAGAAAACAGAAGCATGGAGG + Intergenic
1203274659 22_KI270734v1_random:79372-79394 CAAAGAAAACAGAAGCATGGAGG - Intergenic
1203325548 22_KI270738v1_random:11774-11796 TAGAGAACAGAGAAAAAAGTAGG - Intergenic
949504078 3:4710422-4710444 CAGAGAACACAGACGCCAGAAGG + Exonic
949681437 3:6519111-6519133 AAGAGCACACTGAACAAAGGAGG - Intergenic
949802295 3:7917162-7917184 CAGAAAACACAGAACAGAGGTGG + Intergenic
950626660 3:14252474-14252496 GAGAGAAGAAAGAAGAGAGGAGG + Intergenic
950724566 3:14907945-14907967 CAGGGAACACAGAAAAAACCTGG - Intronic
950907540 3:16552904-16552926 TAGAGAATAGGGAAGAAAGGAGG + Intergenic
951337147 3:21437212-21437234 AAAATAACACAGAAAAAAGGGGG + Intronic
952445142 3:33373815-33373837 CAGAGAAAACAAAAGACAGCTGG - Intronic
952748974 3:36809062-36809084 CAGAGAAGACTGAACAAAGAAGG + Intergenic
952804315 3:37332665-37332687 GAGAGGACACAGAACACAGGAGG - Intronic
952835879 3:37601365-37601387 CAAAGAACACAGAGGTCAGGAGG + Intronic
953195330 3:40726856-40726878 CAGAGCTCTCAGGAGAAAGGGGG + Intergenic
953299395 3:41757233-41757255 CAAAAAATACAGAAGATAGGAGG + Intronic
953697346 3:45170358-45170380 GAGAGAACACATCAGACAGGAGG + Intergenic
953701143 3:45196731-45196753 TAGTGGAGACAGAAGAAAGGAGG + Intergenic
953875136 3:46662374-46662396 GAGAGCACAGAGAGGAAAGGGGG + Intergenic
953903949 3:46858859-46858881 CACAGCACACAGAAGTACGGAGG - Intronic
953991935 3:47490638-47490660 AAGAGAAGAGAAAAGAAAGGTGG + Intergenic
954363137 3:50133001-50133023 CAGAGAAGAAAGAAGAAACGAGG - Intergenic
954461620 3:50630091-50630113 GAGGGAACTCACAAGAAAGGAGG - Intronic
955506116 3:59634872-59634894 CAGAAAACACAGAAGTAGGGTGG - Intergenic
955968635 3:64414325-64414347 CACAGAACACATGAGTAAGGAGG + Intronic
956282654 3:67574138-67574160 CAGAGATGAGAGATGAAAGGAGG - Intronic
956655164 3:71542862-71542884 CAGATAACACAAAAGCATGGAGG + Intronic
956859291 3:73306612-73306634 CAGAGAAGACAGAGGACAGTGGG + Intergenic
957476854 3:80736717-80736739 CAGAGAGGACAGAAGACAAGAGG + Intergenic
957611671 3:82474499-82474521 CCTAAAACACAGATGAAAGGTGG + Intergenic
957646129 3:82930935-82930957 CATGGAAGACAGAAGAAAGTGGG + Intergenic
957960053 3:87237387-87237409 CTGAGAACACAGCAAGAAGGTGG + Intronic
957988961 3:87607235-87607257 GAGAGCACACCGAACAAAGGAGG + Intergenic
958044138 3:88263096-88263118 CAGAGTAGACAGTAAAAAGGAGG + Intergenic
958073996 3:88652802-88652824 CAGAGTAATCAGTAGAAAGGGGG + Intergenic
958516177 3:95119046-95119068 CAGAGAAGGCAGAAAAAAAGGGG - Intergenic
958536862 3:95414986-95415008 GAAAGAAAACAGAAGGAAGGAGG + Intergenic
958871300 3:99562228-99562250 AGGAGAGAACAGAAGAAAGGAGG - Intergenic
959567644 3:107849030-107849052 CAGAAAACACTGCAGAGAGGTGG - Intergenic
959951498 3:112184949-112184971 CACAGAGCACATTAGAAAGGGGG + Intronic
960138558 3:114129989-114130011 CAGAGAACCCAGAACTCAGGAGG + Intronic
960527103 3:118722748-118722770 CAGAGAACACGGAGGTAATGTGG + Intergenic
960853307 3:122077957-122077979 CAAGGAACACAGAAGCAAGGTGG - Intronic
961124486 3:124404057-124404079 CAGGGAAGGGAGAAGAAAGGAGG + Intronic
961964256 3:130886533-130886555 CAGAGAAGACAAAAGAAATAAGG - Intronic
962242026 3:133757720-133757742 ATGGCAACACAGAAGAAAGGAGG - Intronic
962777432 3:138675626-138675648 CAGGGAAGCCAGAAGAAAGTGGG + Intronic
962979114 3:140471913-140471935 CAGAGACCAGAGAGTAAAGGTGG - Intronic
963077117 3:141357245-141357267 CAAACAACACACAAGAAAGAGGG - Intronic
963517449 3:146326309-146326331 CAAAGAACACACAAAAAAGGAGG - Intergenic
963998041 3:151734106-151734128 CAGACAACATTGAAGAAAGCTGG + Exonic
964139820 3:153384835-153384857 CAGAAAAAACAGAAGCAAGCAGG + Intergenic
964820003 3:160757815-160757837 CAGAGGGCAGAGAAGAAAGTTGG - Intronic
965117368 3:164508486-164508508 GAGAGAAAACAGAAGAAAGAAGG - Intergenic
965585511 3:170314372-170314394 CAGTGTGCACAGGAGAAAGGAGG - Intergenic
965602377 3:170467984-170468006 GAGAGCACACAGAAGAAAGCAGG - Intronic
965820373 3:172678962-172678984 AAGAGTACACCGAACAAAGGAGG + Intronic
966141538 3:176762619-176762641 AAGAGAAAACAGAAAAAAAGGGG + Intergenic
967920312 3:194609435-194609457 CAGGAAACACAGAAGAGTGGGGG + Intronic
968079949 3:195839096-195839118 GAGAGAACACCCATGAAAGGAGG + Intergenic
968444742 4:645698-645720 CAGAGAAGGCAGAAAAAAAGAGG - Intronic
968902006 4:3436312-3436334 CTGAGAACACGGCAGGAAGGGGG - Intronic
969680326 4:8639747-8639769 CAGAGAAAACAGAGGCCAGGAGG - Intergenic
970293057 4:14597587-14597609 CAGAGCTCAGAGAAGAAAGAAGG - Intergenic
970398328 4:15694082-15694104 CAGAGAACAAAGGAGACTGGGGG + Intronic
970734709 4:19152349-19152371 CATAAAACCCAAAAGAAAGGAGG - Intergenic
970959823 4:21858334-21858356 AAGAGAACAAAGAAGAAAAATGG + Intronic
971106717 4:23533846-23533868 GTGAGAACACAGCAGTAAGGTGG - Intergenic
971792741 4:31189535-31189557 AAGAGATCACAGAAGATATGAGG + Intergenic
972198889 4:36688548-36688570 CAGAGAACCCAGAAATAAAGAGG - Intergenic
972640245 4:40918737-40918759 CAGAGAAAAAATAAGGAAGGAGG - Intronic
972901351 4:43687947-43687969 CAAACAAAACAGAAGACAGGTGG + Intergenic
973309340 4:48690982-48691004 CAGTGAACACAGAGAAAAAGAGG - Intronic
973538517 4:51909644-51909666 CAGAGAACCCTGTGGAAAGGAGG + Intronic
973563344 4:52159094-52159116 AAGAGAAAAGAAAAGAAAGGAGG - Intergenic
973575812 4:52288314-52288336 AAGGGAACAGGGAAGAAAGGTGG - Intergenic
973636521 4:52866203-52866225 AAGAGAAAAAAGAAAAAAGGGGG - Exonic
973686143 4:53371768-53371790 CTGAGAATACAGCACAAAGGTGG - Intergenic
973938087 4:55871477-55871499 CACAGAACCCAGCAGAAAGTAGG + Intronic
974471200 4:62320077-62320099 CAGAGGACATAGAGGAAAGAAGG + Intergenic
974549525 4:63352998-63353020 GAGAGAGCAGAGAGGAAAGGGGG - Intergenic
974745773 4:66073817-66073839 AAGAGAAAAGAGAAGAAAGCAGG - Intergenic
974811379 4:66950477-66950499 GAGTGAACACAAAAGAAAGGTGG + Intergenic
975789523 4:77933434-77933456 CAGGGAACCCAGAAGTACGGGGG + Intronic
976093809 4:81486628-81486650 CAGAGCACACAGAAGGAGGGAGG + Intronic
976398349 4:84582110-84582132 AAGAGAAAAAAGAAAAAAGGCGG - Intergenic
976693351 4:87892410-87892432 CAGAGTACTTAGAAGAGAGGCGG + Intergenic
976781295 4:88761544-88761566 CACATCACACAGAAGGAAGGAGG + Intronic
976944463 4:90747480-90747502 CAGAGAAAAAAAAAGAGAGGTGG + Intronic
978061154 4:104341209-104341231 AACACAACAAAGAAGAAAGGAGG - Intergenic
978264736 4:106810242-106810264 GAGAGAAGAAAGAAGAAAGAAGG - Intergenic
978366459 4:107988201-107988223 AAGAGTACACCGAACAAAGGAGG - Intergenic
978662234 4:111140722-111140744 TAGAGAACACAAAAGAAAGATGG + Intergenic
980305721 4:131059375-131059397 CATAGAAAACTGAGGAAAGGGGG - Intergenic
981235678 4:142412669-142412691 CAGAGAATACAGAAGAAAGATGG - Intronic
981490984 4:145339121-145339143 GAGAGAACAAAGAAGAAATCTGG - Intergenic
982138949 4:152299215-152299237 CAGAGCACACTGAAGAATGCTGG + Intergenic
982192541 4:152872457-152872479 CAGAGAACACAGACAAAAAGTGG + Exonic
982653037 4:158111208-158111230 CAAAGTTCACAGAACAAAGGAGG - Intergenic
983034023 4:162839927-162839949 CAGAGCACACCAGAGAAAGGTGG - Intergenic
983066606 4:163217417-163217439 AAGAGGAAACTGAAGAAAGGAGG - Intergenic
983521902 4:168717861-168717883 ATGAGAACACAGAAGAAATGAGG - Intronic
984001246 4:174248433-174248455 CACAGAACTAAGAGGAAAGGGGG + Intronic
984019173 4:174464143-174464165 CAAATAAACCAGAAGAAAGGAGG + Intergenic
984126449 4:175816602-175816624 CAGAGAACAGAGAGGAGATGTGG + Intronic
984472125 4:180189679-180189701 GAGAGAAAACAGAAGAAAATAGG + Intergenic
985823470 5:2176658-2176680 CAAGGAACAAAGAAGAAAGATGG - Intergenic
986283831 5:6345593-6345615 CAGAGAACAGAGGAGGAGGGAGG + Intergenic
986288546 5:6378916-6378938 CCGATTACATAGAAGAAAGGAGG - Intergenic
986403913 5:7406570-7406592 CACATAAAACAGAAGAAAAGGGG - Intronic
987075897 5:14381428-14381450 CAAAGGACACAGATGAAGGGAGG - Intronic
987304317 5:16623447-16623469 CAGAGAAAGCTGAAGAAAGCAGG - Intergenic
987390950 5:17375163-17375185 CAGAGACTACAAAAGAAGGGTGG - Intergenic
987793077 5:22593408-22593430 CAGGGAAAACAGGAGAAAGAAGG - Intronic
987910127 5:24132341-24132363 GAGAGAAGAAAGAAGAAAGGAGG + Intronic
988252626 5:28780087-28780109 CAGAGAAGAAGGAAGGAAGGAGG - Intergenic
988922590 5:35957425-35957447 GAGAGATGACAAAAGAAAGGAGG + Intronic
989112745 5:37922969-37922991 CTGAGAACTCAGAAGGAAGAAGG - Intergenic
989129546 5:38093147-38093169 GAGAGGATACAGAAGACAGGGGG - Intergenic
989994002 5:50805287-50805309 CATAGTTAACAGAAGAAAGGAGG + Intronic
990255593 5:53965534-53965556 TAGAGACCACAGAAGAGAGTTGG + Intronic
991017194 5:61944980-61945002 CAGGTAACACAGAGGAAAGCTGG + Intergenic
991141818 5:63253520-63253542 CAGAAAACATTGAAGAAATGAGG + Intergenic
992197719 5:74356297-74356319 CAGAGAATAAAGAAAAAAGAAGG + Intergenic
992643898 5:78794553-78794575 CAGAAAACAAAGAAGAGAGGTGG + Intronic
992741255 5:79775519-79775541 AAGAGAAAACAGGAGAGAGGGGG + Intronic
993046697 5:82874364-82874386 CAAAGAATACAGAAGGCAGGTGG + Intergenic
994016738 5:94975429-94975451 CTGAGCACACAGCAGGAAGGTGG + Intronic
994155832 5:96503472-96503494 AAAAGAAAAGAGAAGAAAGGGGG + Intergenic
994756996 5:103806003-103806025 TAGAGACCACAGAAAAAAGCTGG + Intergenic
994840171 5:104913804-104913826 TAGAGATCACAAGAGAAAGGAGG + Intergenic
995217185 5:109608644-109608666 AAGAGAACAAAGAAGCAATGGGG + Intergenic
995865090 5:116681840-116681862 CTGAAAACACCGAAGAAACGAGG - Intergenic
996271627 5:121612079-121612101 CAGAGAATACAGTATAAAAGGGG + Intergenic
996506381 5:124272177-124272199 AAGAGAAAATAGAAGAAAGGAGG + Intergenic
996529153 5:124509668-124509690 CAGAGTACAAAGAAGACAGGTGG + Intergenic
996547903 5:124700101-124700123 CAGAGAACAAAGAAAAATGAAGG - Intronic
997717993 5:136056407-136056429 CAGAGGCCACAGGAGAAAGGAGG - Intronic
997769081 5:136536380-136536402 CAAAGAAAATAGTAGAAAGGAGG - Intergenic
997777707 5:136626068-136626090 CAGAAATCACAGAAGATAAGTGG - Intergenic
997833827 5:137176323-137176345 CAGTGAACACAATAGCAAGGGGG + Intronic
998209371 5:140182790-140182812 CTATGAAAACAGAAGAAAGGGGG + Intronic
998691771 5:144595339-144595361 CAGATAACCAAGAAGAAAAGAGG - Intergenic
998894346 5:146782807-146782829 GAGAGGAAACAGAAGAAAGAAGG + Intronic
1000693231 5:164348441-164348463 CACAGAAACCAGAAGAAAAGTGG - Intergenic
1001526155 5:172430322-172430344 CAGAGAACAGAAAGGACAGGTGG - Intronic
1001852570 5:174982306-174982328 CAGAAAACAAAGCAGAAACGTGG + Intergenic
1002319377 5:178365897-178365919 CAGTGAACACAGCAGGAAGGGGG + Intronic
1003150495 6:3544028-3544050 CAGAGACCACTTATGAAAGGAGG + Intergenic
1003906889 6:10709283-10709305 CAGTGCACAAAGAAGAAAAGCGG + Exonic
1003954546 6:11149678-11149700 CCCAGGAAACAGAAGAAAGGTGG - Intergenic
1004058857 6:12170843-12170865 CACAGGACACAAAAGTAAGGAGG + Intergenic
1004595355 6:17094349-17094371 GAGAGAAGACAGAGGGAAGGAGG + Intergenic
1004803746 6:19179607-19179629 CAGAGAACAAAGAAGACCAGGGG + Intergenic
1005285060 6:24316345-24316367 CAGAGGACTCAGGAGAAAAGTGG + Intronic
1005436845 6:25821228-25821250 GAGAGAAAAAAGAAGAATGGAGG - Intronic
1005493131 6:26365306-26365328 CAGAGCCCACAGAATAAAGACGG - Exonic
1005896438 6:30183144-30183166 GAGAGAATACAGAAAATAGGAGG + Intergenic
1006193472 6:32223285-32223307 CAGAGAATAAACAGGAAAGGGGG - Intronic
1006206003 6:32343506-32343528 CGGAAAAGACAGGAGAAAGGTGG - Intronic
1006213166 6:32414587-32414609 GAAAGAAAAGAGAAGAAAGGAGG + Intergenic
1006308801 6:33242595-33242617 AAGAGAAGAAAGAAGAAAGGAGG + Intergenic
1006897206 6:37478848-37478870 CAGAGCGCTCTGAAGAAAGGGGG - Intronic
1007273884 6:40659356-40659378 GAGAGCACACAGAAGAGATGTGG + Intergenic
1007407773 6:41644678-41644700 GAGAGATCAAAGAAGAGAGGAGG - Intronic
1007756842 6:44104998-44105020 CAGAAAAAGCAGAAGAAATGTGG + Intergenic
1007780422 6:44250075-44250097 CAGAGTACCTAGAAGAGAGGCGG + Exonic
1007943726 6:45806324-45806346 CAGAAAACAGACAAGTAAGGTGG + Intergenic
1008069040 6:47080540-47080562 GTGAGAACACAGTAAAAAGGTGG - Intergenic
1008265886 6:49425790-49425812 CAGAGAAAAAAGTAGAATGGTGG - Intergenic
1008516483 6:52324057-52324079 AAAAGAAGACAGAAAAAAGGGGG + Intergenic
1008688905 6:53956063-53956085 CAGAGAACACAGAACCCAGAGGG - Intronic
1008772899 6:55001172-55001194 GAGACAAGAAAGAAGAAAGGAGG - Intergenic
1009349148 6:62652786-62652808 CAGAGGAGACAGGAGAAAAGAGG - Intergenic
1009628017 6:66161761-66161783 GAGAGCACACTGAACAAAGGAGG + Intergenic
1009745736 6:67812937-67812959 GAGAGCACACTGAACAAAGGAGG + Intergenic
1009790552 6:68396213-68396235 CGGTGATCACAGAAGAAAAGTGG - Intergenic
1009950736 6:70392795-70392817 CAGAGATAAAATAAGAAAGGAGG + Intergenic
1010043662 6:71417069-71417091 GAGAGAACAGACAAGAATGGTGG - Intergenic
1011092714 6:83624540-83624562 CAGAGAAGAAAGAGGAAAGAAGG - Intronic
1011122583 6:83969802-83969824 AAGAGAACAGAGAAAAAAGGAGG + Intergenic
1011862563 6:91778270-91778292 CAGTGATCACAGAAGAAACCAGG + Intergenic
1011955112 6:93016543-93016565 CAGAGAACTTAGAACAGAGGAGG + Intergenic
1012781160 6:103559294-103559316 CAAAGAACAAAGGAGAAAGGAGG + Intergenic
1012868222 6:104643128-104643150 CACAGAACTCAGAGGAAAGATGG + Intergenic
1012931957 6:105326785-105326807 CAGAGAAAAGAGAAAAATGGAGG + Intronic
1013456462 6:110334094-110334116 GAGAGAAAACAGAGGAAAGGGGG + Intronic
1013721892 6:113040201-113040223 CAAAGAAGAGAGAAGCAAGGAGG - Intergenic
1013956727 6:115850899-115850921 CAGAGAAGAGAGAAGAGAGTAGG + Intergenic
1014161757 6:118177941-118177963 CAGGTAGCACAGAAGTAAGGAGG - Intronic
1015189019 6:130453057-130453079 AAGACAACAGAGAAGAAAAGGGG + Intergenic
1015602952 6:134928230-134928252 CTGAGAAAACAGAAGAAATAAGG + Intronic
1016020300 6:139229895-139229917 AAGACAACTCAGAAGAAAGTGGG - Intergenic
1016453025 6:144203024-144203046 GAGAGCACACTGAACAAAGGAGG - Intergenic
1016751402 6:147634312-147634334 CAGAGCAGAAGGAAGAAAGGAGG + Intronic
1017044977 6:150338380-150338402 GAGATAACAGAGAGGAAAGGAGG + Intergenic
1017492987 6:154960269-154960291 CAGAGGTCTCAGAAGAAGGGAGG - Intronic
1017955737 6:159176354-159176376 CAGAGGACACACAGGCAAGGAGG + Intronic
1018747166 6:166771618-166771640 CAGAGAACAGAAGAGAAATGTGG - Intronic
1018885764 6:167935130-167935152 GAGAGGAGAGAGAAGAAAGGAGG - Intronic
1019035981 6:169059000-169059022 CATAGAACAAAGAAGAAAGGTGG - Intergenic
1019667953 7:2261722-2261744 AAGGGAACACAGAAGCACGGGGG + Intronic
1020083209 7:5297342-5297364 AAGAGTACACAGAATAAAGGAGG - Intronic
1020431353 7:8119364-8119386 CAGAGAACACTGGAAAAAAGAGG + Intronic
1020807899 7:12813339-12813361 CAGAGAACACAAAAGACATTGGG + Intergenic
1020824237 7:13007464-13007486 CAGAGACCACAGAAGGAATTTGG - Intergenic
1020931040 7:14394471-14394493 CAGAAACCACAGTGGAAAGGAGG + Intronic
1021321480 7:19218146-19218168 CAAAGAAAAAAGAAGAAAGCTGG + Intergenic
1021593083 7:22285857-22285879 CAGAGATCCCACAAGAAAGTTGG + Intronic
1022232116 7:28424066-28424088 CAGAGAAGACAGAAGAAGGAGGG - Intronic
1022306022 7:29147227-29147249 TAGATAACACAAAATAAAGGAGG + Intronic
1022381198 7:29861488-29861510 AAGAGAAAACAAAGGAAAGGAGG - Intronic
1022560344 7:31341937-31341959 AAGAGAAAACAGGAGGAAGGTGG - Intergenic
1022898814 7:34781486-34781508 CTAGGAACAAAGAAGAAAGGTGG + Intronic
1023280248 7:38561829-38561851 AAGAGAACACAGCAAGAAGGTGG + Intronic
1023297807 7:38734542-38734564 CAGAGAAATAAGGAGAAAGGGGG - Intronic
1023635150 7:42202261-42202283 GAGAGAACACAGACCAAAGAGGG - Intronic
1023677668 7:42647464-42647486 CAGAGAATAAAGAAGCAAGGTGG + Intergenic
1023842030 7:44103517-44103539 CAGAGGACCCAGAAGGCAGGTGG - Intergenic
1024167152 7:46746527-46746549 AAGAAAACACAGAACAGAGGGGG - Intronic
1024907269 7:54400590-54400612 CATTGAAGTCAGAAGAAAGGAGG + Intergenic
1024919229 7:54540399-54540421 AAGGAAACAAAGAAGAAAGGAGG - Intergenic
1024951073 7:54860846-54860868 CAGAGAGAACAGAGGAAGGGAGG + Intergenic
1025080831 7:55981060-55981082 AAAAGAACACAGAAGAAATAAGG - Intronic
1025319608 7:58081124-58081146 TAGAGAACAGAGAAAAAAGTAGG + Intergenic
1025554104 7:62282350-62282372 TAGAGAACAGAGAAAAAAGTAGG - Intergenic
1025560677 7:62370924-62370946 TAGAGAACAGAGAAAAAAGTAGG + Intergenic
1026244844 7:68610801-68610823 CAGTGAACTCAGATGAAATGAGG + Intergenic
1026600925 7:71776658-71776680 CTGAGAGCAGAGAAGAAAGATGG + Intergenic
1027529172 7:79309028-79309050 GAGAGAACAAAGAGGATAGGTGG - Intronic
1028017845 7:85737701-85737723 AAGAGCACACTGAACAAAGGAGG + Intergenic
1028405270 7:90467319-90467341 CAGTGAAGAGAGAGGAAAGGAGG + Intronic
1028557758 7:92141457-92141479 CAGAGAGAAAAGAAGAAAGCTGG - Intronic
1028619425 7:92808323-92808345 GAGAGAACACACAAGAAAAGAGG + Intronic
1029110087 7:98209643-98209665 GACAAAACACAGAAGAAACGCGG - Intergenic
1029135397 7:98366884-98366906 AAGAGAAGAAGGAAGAAAGGAGG - Intronic
1029171519 7:98632555-98632577 CAGAGGAGACAGAAAAAAAGTGG + Intergenic
1029493181 7:100883379-100883401 GAGGGAAAACAGAAGAAATGAGG - Intronic
1029557550 7:101280802-101280824 CAGTGAACAGGGAGGAAAGGGGG + Intergenic
1029745111 7:102512294-102512316 GAGAGAAAGGAGAAGAAAGGAGG + Intronic
1029763103 7:102611455-102611477 GAGAGAAAGGAGAAGAAAGGAGG + Intronic
1030913166 7:115278362-115278384 CAAAGAACACTGAAGAAGGAGGG - Intergenic
1030988959 7:116276989-116277011 AACAGAAAACAGAAAAAAGGAGG - Intergenic
1031407500 7:121404309-121404331 GAGAGAAGAGAGAAGAAAGTGGG + Intergenic
1031773544 7:125877365-125877387 GAAAGAAAACAGAAGAAAGCAGG + Intergenic
1032225884 7:130031396-130031418 CGGAGAGCACAGAAAAGAGGTGG + Intronic
1032626375 7:133595886-133595908 CAGAGAAGACAGAGGCAAGGTGG - Intronic
1032939268 7:136769580-136769602 CAGAGGAGACAGAAAAAAGTTGG + Intergenic
1033641364 7:143265230-143265252 AAGAGAAGACAGCAGGAAGGCGG - Exonic
1033901713 7:146150082-146150104 CAGACAACACAGTAAAAATGGGG + Intronic
1034366488 7:150553466-150553488 AATAGAAAACAGAAAAAAGGAGG + Intergenic
1034405865 7:150902105-150902127 CAGGACACACAGAAGGAAGGAGG + Intergenic
1034412390 7:150948149-150948171 GAAAGAACATAGAACAAAGGAGG - Intronic
1034818558 7:154196091-154196113 CACAGAACAGAGAGGAGAGGAGG - Intronic
1034939969 7:155224261-155224283 CACAGAGGAAAGAAGAAAGGAGG + Intergenic
1035241594 7:157534159-157534181 CAGACAACAGAGAAAAGAGGGGG - Intergenic
1035245450 7:157559838-157559860 GAGAGAACACAGGAGAGAGACGG - Intronic
1035635236 8:1139237-1139259 CAGAGAACACAGGGGCAACGAGG - Intergenic
1035669826 8:1408853-1408875 CAGGGCACAGAGAAGAAAGCTGG + Intergenic
1035675342 8:1451922-1451944 CAGATAACACGGAAGAGAGCAGG - Intergenic
1035886456 8:3296380-3296402 CTGAGAGCAGAGAAGAATGGGGG + Intronic
1035939835 8:3886786-3886808 CAAAGATTACAGAAGGAAGGAGG + Intronic
1035959451 8:4120814-4120836 CAGAAATCACAAAACAAAGGAGG + Intronic
1036062125 8:5335183-5335205 CACAGAAAACAGAAGATACGAGG - Intergenic
1037590552 8:20308391-20308413 CAGAGAAGACAGAGGAGAGATGG - Intergenic
1038201870 8:25420416-25420438 CACAGAACAAAGAAAAAAGTGGG - Intronic
1038348526 8:26755190-26755212 CAGAGAAAAAAAAAAAAAGGAGG - Intronic
1038672482 8:29593391-29593413 AAAAGAATACAGAAGAAAAGAGG - Intergenic
1039297653 8:36174267-36174289 CAGAGAAAACAGAGGCAATGTGG - Intergenic
1040737449 8:50526167-50526189 CAGAGAACACAGAAGAGTTCAGG - Intronic
1040740732 8:50571328-50571350 AAGAGAACACAGCAGGAATGTGG + Intronic
1041150804 8:54931713-54931735 GGGAGAAATCAGAAGAAAGGAGG - Intergenic
1041337284 8:56800538-56800560 CATAGAATACAGAAGGAAAGGGG + Intergenic
1041453371 8:58031841-58031863 GAGAGAAGAAAGAAGGAAGGAGG - Intronic
1041543331 8:59011736-59011758 CATTAAACTCAGAAGAAAGGTGG - Intronic
1041629410 8:60068874-60068896 AAGAGAACAAAGAAGAGAGGGGG - Intergenic
1041744038 8:61186647-61186669 AAGAGAAGACAAAAGAAGGGAGG + Intronic
1043277196 8:78413550-78413572 AAGAGAACAGAGAAGAATGGGGG - Intergenic
1043318222 8:78947830-78947852 CAGAGAACCCAGCTGAAACGTGG + Intergenic
1043331135 8:79120179-79120201 AAGAGCACACCGAACAAAGGAGG - Intergenic
1043331705 8:79124518-79124540 AAGAGCACACCGAACAAAGGAGG - Intergenic
1044099760 8:88120187-88120209 AAAAGAAAACAGAAGGAAGGAGG + Intronic
1044307218 8:90651765-90651787 CACCGAACCCAGAAGAAAAGGGG - Intronic
1044431816 8:92116433-92116455 CTGAGAAAAAAGAATAAAGGTGG - Intergenic
1045383492 8:101649088-101649110 CAAATAACACAGAGGAAAAGAGG + Intronic
1045513398 8:102833542-102833564 TAGATATCACAGAAGGAAGGAGG + Intronic
1045544242 8:103113889-103113911 CAGCAAACACAGTAGAAGGGAGG + Intergenic
1046057175 8:109092916-109092938 CAGTGAAAACATAAGAAAAGCGG - Intronic
1047158367 8:122348072-122348094 CAGAAGAGAAAGAAGAAAGGAGG + Intergenic
1047576517 8:126161676-126161698 CAGAGTACACAGGAGAAACTTGG + Intergenic
1048473423 8:134722957-134722979 CAGAAGACACAGAGAAAAGGTGG + Intergenic
1048670000 8:136707717-136707739 CAGAAAACTCATTAGAAAGGTGG - Intergenic
1048959544 8:139564527-139564549 GGGAGAACACTGAACAAAGGAGG + Intergenic
1049230896 8:141480599-141480621 CATAGAACAAAGAAGAGAGCTGG - Intergenic
1049288125 8:141787571-141787593 CAGAGAACAGAGAGGGAGGGAGG + Intergenic
1049792107 8:144476864-144476886 TAGGGAACACAGCAGAGAGGTGG - Intergenic
1049827725 8:144680380-144680402 CAGAAAACACAGAAATAAGCAGG + Intergenic
1050144123 9:2547513-2547535 TAGAAAACACAGAAGAAAACAGG + Intergenic
1050176567 9:2875340-2875362 CAGTCATCACAGAAGCAAGGAGG - Intergenic
1050429559 9:5548803-5548825 CAAAGAAAACAGAGGAAAGGAGG + Intronic
1050437337 9:5625133-5625155 AAGAGTACACATAAGAAATGGGG - Intergenic
1050722945 9:8611751-8611773 AAGAGAAAAGAAAAGAAAGGAGG + Intronic
1050846977 9:10233336-10233358 CAGAGAACACAAAACAATGAAGG - Intronic
1051214257 9:14779398-14779420 CAGAGAAGGAAGAAGAAAGAAGG + Intronic
1051480534 9:17555379-17555401 CAGAGAAAAGATAACAAAGGAGG + Intergenic
1051535416 9:18152146-18152168 CAAAGCACACAGCAGAGAGGTGG + Intergenic
1051661079 9:19427632-19427654 AAGAGAAGAGAAAAGAAAGGAGG - Intronic
1052267952 9:26595854-26595876 CTGGGAACAGAGAAGAGAGGTGG - Intergenic
1052313870 9:27096532-27096554 CAGAGAACTCAGAAGAAGACAGG + Intergenic
1052394620 9:27923927-27923949 TAGAGAACAGAGAACAAGGGTGG + Intergenic
1052417223 9:28191564-28191586 CAAAGAAGATGGAAGAAAGGGGG - Intronic
1053062186 9:35040957-35040979 AAGAGTACACCGAACAAAGGAGG + Intergenic
1055199002 9:73634156-73634178 CAGAGAACACTGAAGCAGGAAGG + Intergenic
1055857634 9:80710060-80710082 CAGGGGACACAGAGGAGAGGAGG - Intergenic
1055913946 9:81380955-81380977 CATGGAACAGAGAAGGAAGGCGG + Intergenic
1056331467 9:85524490-85524512 CAGAAAAGGCAGAAGAGAGGTGG - Intergenic
1056665296 9:88576785-88576807 CAGAGAACCCAGAGGAAAGCAGG - Intronic
1056695849 9:88851389-88851411 AAGAGAACACAGCAAGAAGGTGG + Intergenic
1057500100 9:95590031-95590053 CAGAGAAGACAGAAGGACCGAGG - Intergenic
1057895085 9:98902944-98902966 CATAGAAGATAGAAGAAAGAAGG - Intergenic
1058503675 9:105647768-105647790 CAGAGAATAAAGAAGGAAAGGGG + Intergenic
1058872682 9:109216196-109216218 CAGAGAACTGTTAAGAAAGGAGG + Intronic
1059251826 9:112892647-112892669 CAGAGAACTCAGAAGCCTGGGGG - Intergenic
1059514237 9:114878119-114878141 GAGAGAATAGAGAAGAGAGGAGG + Intergenic
1059547680 9:115194667-115194689 AAGAGAACACCGGAGAAAGGAGG - Intronic
1059638882 9:116196741-116196763 AAGAGAAGAAAGGAGAAAGGAGG - Intronic
1059684763 9:116624491-116624513 ATGAGAATACAGAAGGAAGGGGG + Intronic
1059819602 9:117957324-117957346 AAAACAACACAGAGGAAAGGTGG - Intergenic
1060341532 9:122781545-122781567 TAGAGGACTCAGAAGCAAGGTGG + Intergenic
1060344648 9:122805624-122805646 CAGAGAACAAAAAGGGAAGGAGG - Intronic
1061026971 9:128056051-128056073 CACAGAACACAGAACACAGTGGG - Intergenic
1061781082 9:132996395-132996417 CCGAGAACACAGAAGAATCTGGG + Intergenic
1061787359 9:133037938-133037960 CAGAGCACACGGAACAAAGGAGG + Intronic
1061829018 9:133278817-133278839 AAGAGCACACTGAACAAAGGAGG + Intergenic
1061949212 9:133926842-133926864 CAGAGCACACAGAAGCAGAGAGG + Intronic
1061954077 9:133952686-133952708 AAGAGAAGACAGAAGACAAGAGG + Intronic
1062258634 9:135644996-135645018 AAGAGCACACTGAACAAAGGAGG - Intergenic
1203631183 Un_KI270750v1:73855-73877 CAGAGCAGACAGAAGGCAGGAGG - Intergenic
1185524953 X:770422-770444 AAAAGAAGAAAGAAGAAAGGAGG + Intergenic
1186124763 X:6401233-6401255 ATGAGAACAAAGAAGAAAAGAGG - Intergenic
1186299807 X:8187920-8187942 CTGAACACACAGAAGAAATGGGG + Intergenic
1186444496 X:9615141-9615163 CATATAACACAGGAGAAAAGGGG - Intronic
1187439165 X:19302416-19302438 CAGGGAAAACAGAAGACAGATGG - Intergenic
1187658084 X:21503887-21503909 CAGGTAAAAGAGAAGAAAGGCGG - Intronic
1188220047 X:27530360-27530382 TATAGAAAACAGAAGAATGGCGG - Intergenic
1188643453 X:32535284-32535306 CAGAAAGTACAGAAGAAATGTGG - Intronic
1188752616 X:33922836-33922858 CATAGAACAGAGATGAAGGGTGG - Intergenic
1188805003 X:34577337-34577359 CAGTGAACACTGGAGAAAGCTGG - Intergenic
1188843102 X:35039608-35039630 AACAGAAAACAGAAAAAAGGAGG + Intergenic
1190462856 X:50695946-50695968 CAGAGAACAAAACAGAAAGCAGG + Intronic
1190489223 X:50964499-50964521 GAGAGAACAAAAAAGAAAGAGGG + Intergenic
1190620286 X:52280780-52280802 GAGAGCACACTGAACAAAGGAGG + Intergenic
1190639298 X:52467220-52467242 CAGTGAACACATAAGATGGGAGG - Intergenic
1191233684 X:58117366-58117388 GAGAGCACACCGAACAAAGGAGG - Intergenic
1191764488 X:64682365-64682387 CAGGGGACACAGGAGGAAGGGGG + Intergenic
1192871921 X:75192783-75192805 AACAGAAAACAGAAGAAAGAAGG - Intergenic
1193269737 X:79515291-79515313 GAGAGGACAGAGAAGGAAGGAGG - Intergenic
1193319608 X:80106126-80106148 CAGAGCACAGAAAAGAAAAGTGG + Intergenic
1193367018 X:80646816-80646838 TAGAGAACACAGGAGAAAGAAGG - Intergenic
1193824305 X:86204202-86204224 GAGAGAACAATGAAGAAAGCAGG - Intronic
1194046921 X:89019027-89019049 TAGAGAACACAGAAAAAATTTGG + Intergenic
1195250720 X:103043549-103043571 CAGAGAAGACAGAAAAAGAGTGG - Intergenic
1195743085 X:108086181-108086203 CATTCAACACAGAAGAAAAGTGG + Intronic
1195977793 X:110546454-110546476 AAGAGGACACAGAAAGAAGGTGG + Intergenic
1196222961 X:113133800-113133822 CAGAGAACACCAAAGACAGAAGG - Intergenic
1196839059 X:119841226-119841248 AAGAAAAGAGAGAAGAAAGGAGG - Exonic
1197072610 X:122317998-122318020 CAGAGATCACAGAAGGCTGGTGG - Intergenic
1197224317 X:123941277-123941299 CAGAGAAAAAGGAATAAAGGTGG + Intergenic
1197470145 X:126857054-126857076 CAGAGGACACAAAAGAAAAAAGG + Intergenic
1198411937 X:136379482-136379504 AGGAGAAGACAGGAGAAAGGAGG - Intronic
1198545010 X:137682300-137682322 CCCAGCAGACAGAAGAAAGGAGG - Intergenic
1198588706 X:138151256-138151278 CACAGAACAAAGAAGAAAAACGG - Intergenic
1198693548 X:139310632-139310654 AAGCGAACACAGAAAAAAAGGGG - Intergenic
1199234463 X:145474957-145474979 CAGAGGACACCAAAGGAAGGAGG + Intergenic
1199633956 X:149797449-149797471 CAGAGAAAATAGAAGAGAAGGGG - Intergenic
1200386232 X:155893632-155893654 CTGAGAACACAGCAAGAAGGTGG - Intronic
1200895659 Y:8373578-8373600 AAGTGAATACAGAAGAAAGTTGG - Intergenic
1201606644 Y:15792921-15792943 ATGAGAACAAAGAAGAAAAGAGG - Intergenic
1201646191 Y:16235105-16235127 CACAGAACAGAGAAGAATGTGGG + Intergenic
1201656622 Y:16350212-16350234 CACAGAACAGAGAAGAATGTGGG - Intergenic
1201679584 Y:16629184-16629206 CAGAGGAACCAGAAGACAGGAGG + Intergenic
1201716783 Y:17053330-17053352 CAGAGAACCCAAAAGAAAGCAGG - Intergenic