ID: 1117483937

View in Genome Browser
Species Human (GRCh38)
Location 14:56174863-56174885
Sequence TAGTGGGAAAGGAGGGTAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 492
Summary {0: 1, 1: 0, 2: 1, 3: 37, 4: 453}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117483937 Original CRISPR TAGTGGGAAAGGAGGGTAAA AGG (reversed) Intronic
900040638 1:460296-460318 CAGAGGGAAAGGAGTTTAAAGGG + Intergenic
900062068 1:695267-695289 CAGAGGGAAAGGAGTTTAAAGGG + Intergenic
901169072 1:7242327-7242349 TAGTGGGAATGAATGGAAAATGG + Intronic
902192083 1:14770908-14770930 TACTGAGAAAGGAGGGTAAGGGG + Intronic
903743827 1:25573603-25573625 TGGGGGGCAGGGAGGGTAAAAGG + Intergenic
905242920 1:36592776-36592798 TAGTGGGAAAGTATGGAACAGGG - Intergenic
905826645 1:41030646-41030668 TAGGGGGAAACTAGGGTAATTGG - Intronic
905854811 1:41302591-41302613 AAATGGGACAGGAGGGTCAATGG - Intergenic
905922584 1:41729236-41729258 TAGAGGGAAAGGCAGGGAAAGGG - Intronic
907385339 1:54122139-54122161 TAGTGGGAAGGGAGAGTTCAAGG - Intergenic
907560003 1:55379555-55379577 TGGTGAGGAAGGAGGGCAAAGGG - Intergenic
909837134 1:80270433-80270455 TAATGGGAAAGGAGGCAAGAGGG - Intergenic
911140955 1:94502081-94502103 AAGTGGGAAAGGAAGTTAAGGGG - Intronic
911165672 1:94722353-94722375 TGGTGGGAAAGGAGGGGACAGGG + Intergenic
912474680 1:109928028-109928050 TACTGGGTAAGGAGGGAAGATGG - Intronic
912944657 1:114074927-114074949 TAGTGGGGAGGGATGGTAAATGG + Intergenic
913520980 1:119646145-119646167 TACTGGGATAGAGGGGTAAATGG - Intronic
913566374 1:120076764-120076786 GAGTGGGAAAGGAAGATGAAAGG + Intergenic
913631757 1:120716785-120716807 GAGTGGGAAAGGAAGATGAAAGG - Intergenic
914287135 1:146237480-146237502 GAGTGGGAAAGGAAGATGAAAGG + Intergenic
914425292 1:147570578-147570600 GAGTGGGAATGGGGGGCAAAGGG - Intronic
914548167 1:148688222-148688244 GAGTGGGAAAGGAAGATGAAAGG + Intergenic
914618516 1:149383482-149383504 GAGTGGGAAAGGAAGATGAAAGG - Intergenic
914755995 1:150561913-150561935 GAGTGGGGAAGGAGGCAAAAGGG + Intergenic
914980508 1:152410695-152410717 AAGTGGGAAGGGCGGGGAAAGGG - Exonic
916048653 1:161019636-161019658 TAGTGGGAAAGTAAGTTTAAAGG + Intronic
916425467 1:164675936-164675958 TAGTGAGAAAAGAGGGTGAGAGG - Intronic
916636420 1:166674182-166674204 TAGTGGGATGAGAGTGTAAAAGG - Intergenic
916845065 1:168642382-168642404 TATTGGCAAAGGAGGGAACAGGG - Intergenic
917746301 1:178011247-178011269 CAGTGGGAAATGAGGGGAAAGGG + Intergenic
919731085 1:200914018-200914040 TAGTGGGACAGGAGGGCCAGGGG - Intronic
920002996 1:202812049-202812071 TTGTTGAAAGGGAGGGTAAATGG + Intergenic
920209815 1:204320106-204320128 TGGTGGGAAAGGAGAGAATAAGG - Intronic
920663234 1:207937475-207937497 TTGTGGGGCAGGAGAGTAAATGG - Intergenic
920710128 1:208287115-208287137 CAGTGGGAAACCAGGGAAAATGG - Intergenic
921516057 1:216093569-216093591 CTGTAGGATAGGAGGGTAAAGGG - Intronic
922116010 1:222615592-222615614 TGTTAGGAAATGAGGGTAAAAGG + Intergenic
922553112 1:226511723-226511745 TAGTAGGGAAGGAGGGTAAGGGG + Intergenic
922640085 1:227221531-227221553 TAGTGGGAAGGGAGGGTGGGTGG - Intronic
923935800 1:238758854-238758876 GAGTAGAAAAGGAGGGCAAATGG + Intergenic
1062812569 10:477544-477566 AAGGGGGAAAGGAAGGTAGATGG + Intronic
1062822403 10:544532-544554 TAGTGGGAGGGGAAGGAAAATGG - Intronic
1063211448 10:3884658-3884680 TCGTGGGAAAGGGGGCAAAATGG + Intergenic
1063964434 10:11335669-11335691 TAGTGGGAAAGGATGGCTAAGGG + Exonic
1064892871 10:20198154-20198176 GAGTAGGATGGGAGGGTAAAAGG + Intronic
1066227683 10:33400168-33400190 GAGTGGGAAGGGAAGGGAAATGG - Intergenic
1066986559 10:42473596-42473618 TAATCTGGAAGGAGGGTAAATGG + Intergenic
1068643886 10:59443985-59444007 TAGTGGGAATGTGGGGAAAAGGG + Intergenic
1069506001 10:68998635-68998657 TAGTGGCAAAAGATGGTAGAAGG + Intronic
1069556649 10:69402697-69402719 GGGTGGGAAGGGAGAGTAAAAGG - Intergenic
1069652897 10:70063981-70064003 TAGTAGTAAAGGAGGGAGAAAGG - Intronic
1069710955 10:70488481-70488503 GAGAGGGGAAGGAGGGGAAAGGG - Intronic
1070127158 10:73631811-73631833 TTATGGGAATGGAGGGAAAAAGG - Exonic
1072079413 10:92013093-92013115 TAAAGGGGAAGGTGGGTAAAAGG + Intronic
1072383745 10:94902022-94902044 TAGTGGGAGAGGAAGGTAGGAGG + Intergenic
1072934829 10:99702112-99702134 TAGTAGGAAAGCAGGGTGACAGG - Intronic
1073181858 10:101588228-101588250 AAGGGGGGAAGGAGGGCAAATGG + Exonic
1073605756 10:104894238-104894260 TAGTGTTAGAGGAGGGAAAAAGG + Intronic
1073665070 10:105522350-105522372 TTGTGGAAAAGCATGGTAAATGG + Intergenic
1075013991 10:118896732-118896754 TATTGGGATAGGAGAGTATATGG - Intergenic
1075312310 10:121424701-121424723 TGGTGTGGAAGGAGGGTAGAGGG + Intergenic
1076494912 10:130890753-130890775 AAGTGGGAAAGGAGGGGGAAGGG + Intergenic
1076966911 11:96519-96541 CAGAGGGAAAGGAGTTTAAAGGG + Intergenic
1077347503 11:2070666-2070688 TAGTGGGACAGGATGGTGGAGGG - Intergenic
1077560964 11:3260722-3260744 CTGTGGGAGAGGAGGGTAATTGG + Intergenic
1077566861 11:3306552-3306574 CTGTGGGAGAGGAGGGTAATTGG + Intergenic
1078964334 11:16320344-16320366 TAATGGGAAAAGGGGGGAAAAGG + Intronic
1079100602 11:17539270-17539292 TGGGGAGACAGGAGGGTAAAGGG - Intronic
1079478162 11:20853245-20853267 GTGTGGGAAAGGAGAGGAAAAGG + Intronic
1080047986 11:27829383-27829405 TTGTGGGAAAGCTGGGTGAAGGG + Intergenic
1080272805 11:30468532-30468554 AAGGGGAAAAAGAGGGTAAAAGG + Intronic
1080294147 11:30705597-30705619 TCGTGGGTAAGGAGGCAAAAAGG + Intergenic
1080840135 11:35976358-35976380 TGGTGGGAAAGGAGGGTAGGAGG + Intronic
1080887334 11:36378188-36378210 TAGCGGGTCAGGAGGGGAAATGG + Intronic
1081192412 11:40119988-40120010 TTATGGGAAGGCAGGGTAAATGG - Intronic
1081430390 11:42970244-42970266 TAGTGGGTAGGGAGGATCAATGG - Intergenic
1081654422 11:44848180-44848202 TTGTGGGAAAGGAGGATGAGGGG + Intronic
1081664179 11:44906776-44906798 GAGTGGGAAAGGAGGGGATGGGG + Intronic
1081996363 11:47367092-47367114 TAGTTGGAAAGGTGGCTAAGTGG + Intronic
1082132350 11:48506184-48506206 GAGGGGGAAGGGAGGGGAAAGGG - Intergenic
1085553240 11:77394949-77394971 TGGTGGGAAATGAGGCTAATTGG - Intronic
1085939234 11:81188337-81188359 AAGTGGGAAAAGAGGAAAAAAGG + Intergenic
1086124426 11:83335562-83335584 TGGTGGGAAAGGAGCTCAAAAGG - Intergenic
1087029602 11:93689642-93689664 TGGGGGGAAAGCAGGGTAAAGGG - Intronic
1087628829 11:100626695-100626717 GAGTGTGAAAGGAGGGAACAAGG + Intergenic
1088048875 11:105486288-105486310 TAGTGAGAGAGGATGGTAAGGGG + Intergenic
1088763898 11:112958469-112958491 CAGTGGGAAAGGAGGCAAAAAGG - Intergenic
1089096229 11:115922302-115922324 TAGGGGCAAAGGAGGTTGAAGGG - Intergenic
1089906257 11:122042594-122042616 TATTTGGAAAGCATGGTAAAGGG - Intergenic
1090234826 11:125139588-125139610 TGGTGGGGAAGGAGGGCGAAAGG - Intergenic
1091081570 11:132673907-132673929 TAGTGGGTTAGGAGAGAAAAGGG - Intronic
1094529601 12:31261668-31261690 TATTTTTAAAGGAGGGTAAATGG + Intergenic
1095168628 12:39006152-39006174 GAGCTGGAAAGGAGAGTAAAGGG + Intergenic
1095621967 12:44267657-44267679 GAGGGAGAAAGGAGGGTCAAAGG - Intronic
1096309225 12:50505379-50505401 GGGTGGGAGAGGAGGGAAAACGG - Intronic
1097592096 12:61587311-61587333 TAGTGGAAAAGTATAGTAAAAGG - Intergenic
1098268737 12:68749985-68750007 AAGAGGGAAGGAAGGGTAAAAGG + Intronic
1098469398 12:70826309-70826331 TAGTGGGAAAGGTGAGAAGAGGG + Intronic
1099713293 12:86257242-86257264 CAGTGGGAGAGGAGGATAATGGG + Intronic
1100722033 12:97369341-97369363 CAGGGGGAAAGGATGGAAAAGGG + Intergenic
1100955663 12:99905145-99905167 TAGTCTGAATTGAGGGTAAAGGG + Intronic
1101201043 12:102436602-102436624 TTGTGGCAAAGGAGGGTGGAAGG + Intronic
1102099399 12:110266842-110266864 CAGTGGGGAGGGAAGGTAAAGGG - Intergenic
1102797125 12:115698286-115698308 GAGGGGAAAAGGAGGGGAAAGGG + Intergenic
1104071934 12:125353406-125353428 TAGAGGAAAAGGAGGGCAGATGG + Intronic
1104781250 12:131421997-131422019 ACGTGGGAGAGGAGGGTAAGGGG - Intergenic
1105870548 13:24502157-24502179 TAGTGGAAAGGGAGGTTCAAAGG + Intronic
1105918009 13:24934935-24934957 TAGTGGAAAGGGAGGTTCAAAGG - Intergenic
1106075488 13:26457352-26457374 AAGTGGGAGAGGAGGGGACAAGG - Intergenic
1106406980 13:29482999-29483021 TAGTGGGAGAGGAGACTCAAGGG + Intronic
1106766755 13:32921111-32921133 TAGTGGGAAATGAGGAAACATGG - Intergenic
1107124265 13:36829281-36829303 TAATGGGAAAGGAGGGAAATGGG + Intergenic
1107367130 13:39693272-39693294 AAGAGGGAAAGGAGGGAGAAAGG - Intronic
1107804980 13:44145267-44145289 TAGTGGGAAAGGAGTGAGGATGG + Intronic
1109432791 13:62257540-62257562 TACTGGGATAAGAGGGGAAATGG - Intergenic
1110023329 13:70503913-70503935 TATTGGGGAAGCTGGGTAAAGGG + Intergenic
1110343633 13:74420584-74420606 TAGTGGGAAAGGGGGAGAAAAGG + Intergenic
1110475927 13:75913389-75913411 GGGTGGGAAAGGAAGGTAAGAGG + Intergenic
1111477484 13:88771497-88771519 AAGGGGGAAAGGAGAGTGAAGGG - Intergenic
1112807305 13:103176969-103176991 TCGGGGGAAAGGAGAGGAAAAGG - Intergenic
1113433884 13:110273919-110273941 TAGTGAGAAAGGAAGGGAAATGG - Intronic
1113796533 13:113061742-113061764 GAGAGGGAAGGGAGGGGAAAGGG - Intronic
1115967080 14:38902639-38902661 TAGTGGGGAAGTAGGACAAATGG - Intergenic
1117483937 14:56174863-56174885 TAGTGGGAAAGGAGGGTAAAAGG - Intronic
1117525582 14:56599235-56599257 CAGAGGGACAGGAGGGCAAAAGG - Intronic
1117834917 14:59794004-59794026 CAGTGGGAGAGGAGTGTAATGGG - Intronic
1118881929 14:69836216-69836238 TGGTGTGAAAGGAGGGGACAGGG - Intergenic
1119294362 14:73521048-73521070 GGGTGAGAAAGGAGGGAAAAGGG + Intronic
1119310138 14:73639314-73639336 AGGTGGGAAAGGTGGGTAAGTGG - Intergenic
1119344260 14:73909269-73909291 TGGTGGGAAAAGAGAGTAACAGG + Intronic
1120244979 14:81995753-81995775 AAGGGGGAAAGGAGAGTAAGTGG - Intergenic
1120571483 14:86122636-86122658 TAGAGGGATTGGAGGGGAAAAGG + Intergenic
1121555255 14:94831662-94831684 CAGTGGGAATGGAGGGCAGAAGG + Intergenic
1121638186 14:95467741-95467763 CAGTGGGCAAGGAGGGTAAATGG + Intronic
1122762611 14:104040686-104040708 TACTGGGAAAGGAGGACACAAGG + Intronic
1202894880 14_GL000194v1_random:1291-1313 TTGTGGGACAGGAGGGTCACTGG + Intergenic
1123541126 15:21292741-21292763 AAGGGGGAAAGGAGGGAAGAAGG + Intergenic
1123989224 15:25671051-25671073 TAGTGGGAAGGGAGGGGATAAGG + Intergenic
1125242426 15:37591165-37591187 AAATGGGAAAGGAAGGTATAAGG - Intergenic
1125321108 15:38490015-38490037 TAGTGAGGAAGGAGGGTACATGG + Exonic
1125408828 15:39383513-39383535 TAGTGGGTAAGGTGGGAAAAGGG + Intergenic
1125932291 15:43609106-43609128 TGGAAGGAAAGGAGGGCAAAGGG + Intronic
1125945387 15:43708578-43708600 TGGAAGGAAAGGAGGGCAAAGGG + Intergenic
1126257461 15:46644437-46644459 AAGTGGAAAGGGAGGGGAAATGG + Intergenic
1126584949 15:50275599-50275621 TAGAGAGAAAAGAGGATAAATGG - Intronic
1126704717 15:51396419-51396441 TTGTGGGAGAAGAGGGTAAGGGG + Intronic
1126978669 15:54216143-54216165 TAGAGGCAAAGGAGGGGTAAAGG + Intronic
1127013279 15:54653876-54653898 TAATGGGAAAGAAGGGAAGAAGG - Intergenic
1127396174 15:58545718-58545740 TAATGGGAAAGCAGGGGTAAGGG - Intronic
1128550741 15:68596518-68596540 TGGTGGGAAAGGAGATTGAAGGG + Intronic
1131619295 15:94050233-94050255 AAGTGGGAGAGGAGGATAAGGGG - Intergenic
1132441265 15:101867316-101867338 CAGAGGGAAAGGAGTTTAAAGGG - Intergenic
1202949439 15_KI270727v1_random:19882-19904 AAGGGGGAAAGGAGGGAAGAAGG + Intergenic
1133206931 16:4239609-4239631 GAGTGTGAAAGGAGGAGAAAGGG - Intronic
1133551223 16:6856129-6856151 TAAAGGGAAGGGAAGGTAAAGGG - Intronic
1133807951 16:9139359-9139381 TCCGGGGAAAGGAGGGCAAAGGG - Intergenic
1134626404 16:15725762-15725784 GAGTGGCAAGGCAGGGTAAATGG + Exonic
1135305247 16:21362266-21362288 TGGTGGGAGAGGAGGGTAAGTGG - Intergenic
1135681790 16:24463476-24463498 TGGGGGGAAAGGAGGGGAGATGG + Intergenic
1135962562 16:27009858-27009880 CACTGGGAAAGTGGGGTAAAGGG + Intergenic
1136106444 16:28033533-28033555 GAGGAGGAAAGGAGGGGAAAGGG + Intronic
1136238336 16:28928652-28928674 TAGTGAGAAAGGAGAATAAAAGG + Intronic
1136301992 16:29341431-29341453 TGGTGGGAGAGGAGGGTAAGTGG - Intergenic
1138051892 16:53787304-53787326 AAGTGGGAAAGCAGGTTAATAGG + Intronic
1138413870 16:56860182-56860204 TACTGGGAGATGAGGCTAAAAGG - Intergenic
1138691555 16:58773549-58773571 TAATGGAAAAGGGGGGTTAAAGG - Intergenic
1139615063 16:68084054-68084076 CAGTGGGAAGAGAGGGTAAAGGG - Intergenic
1140162345 16:72510874-72510896 TGGGGGGAAAGGTGAGTAAAGGG - Intergenic
1141137712 16:81477506-81477528 CAGTGGGAAAGGAGGGGACCTGG - Intronic
1141417348 16:83886207-83886229 TAAAGGGAAAGGAGGGGACACGG + Intergenic
1143306752 17:5953573-5953595 TAGAGTAAGAGGAGGGTAAAAGG + Intronic
1143451141 17:7037396-7037418 TAATGGGACTGGAGTGTAAAAGG + Intronic
1143527602 17:7481573-7481595 TTTTAGGAAAGGAGGGGAAATGG - Intronic
1144051617 17:11501857-11501879 TAGTGGAAAAGGAGAGAAAAGGG + Intronic
1144103967 17:11969578-11969600 TAGAGGGACAGGTGGGTGAAGGG + Exonic
1145087677 17:19956489-19956511 AAGTGGGAATGAAGGGTGAAAGG + Intronic
1145405295 17:22585062-22585084 TATTGGGAAAAAAGGGAAAAAGG + Intergenic
1145786073 17:27594711-27594733 TAGCGGGAAAAGAGGTCAAAGGG - Intronic
1146547117 17:33749229-33749251 TAGGGGGAAAGGGAGGGAAAGGG - Intronic
1146705289 17:34996733-34996755 AGGTTGGAAAGGAGGGTACAGGG + Intronic
1147685936 17:42286991-42287013 GAGTGGGAAAGGAGAGGAGAGGG + Intergenic
1148099271 17:45078152-45078174 AAGTGGGAAATGAGGGTGATAGG + Intronic
1148583764 17:48762186-48762208 TAATGGGAAAGGAGGGTTGTGGG - Intergenic
1149603337 17:57907459-57907481 TAGTGGGAAAGTGGGGGTAAGGG + Intronic
1150182910 17:63145303-63145325 GAGTGGGAAAGAAGGGTAGAAGG - Intronic
1150451320 17:65271232-65271254 TGGTGGGAAAAGAGGGGAGAGGG + Intergenic
1152975955 18:218474-218496 GAGTGGGCAACGAGGGCAAAGGG + Intronic
1153040028 18:803713-803735 AGGTGGGAAAGGAGGGTGACTGG + Intronic
1153864397 18:9250397-9250419 TAGTGGGAATAGAGAGAAAACGG + Intronic
1155122622 18:22838584-22838606 AAGTGGGGAAGAAGGGGAAATGG - Intronic
1155715080 18:28932359-28932381 GTGTGGGAAAGCAGGGTATAGGG + Intergenic
1155908965 18:31486853-31486875 GAGTGTAAAATGAGGGTAAAGGG - Intergenic
1155941800 18:31807728-31807750 AAGAGGGAAATGTGGGTAAATGG - Intergenic
1155947184 18:31868106-31868128 CAGTGGGAGAGAAGGGAAAAAGG + Intronic
1157525124 18:48374815-48374837 TGGTGGGAGAGGTGGGTACAGGG - Intronic
1157781376 18:50442588-50442610 TAATGGGAATGGGAGGTAAATGG + Intergenic
1159380818 18:67656319-67656341 AAGTGGGAAATGAGTTTAAATGG - Intergenic
1159879953 18:73849523-73849545 TAGAGGGAAAGAAGGGGAGAGGG + Intergenic
1160469656 18:79117592-79117614 TAGTTGGAAAGGAGGTCAGAGGG + Intronic
1160643714 19:166142-166164 CAGAGGGAAAGGAGTTTAAAGGG + Intergenic
1161237290 19:3204380-3204402 CAGTGGGTAAGGAGGGACAAGGG - Intronic
1161258896 19:3324720-3324742 TAGTGGGAAGAGAGGGAAGAAGG - Intergenic
1164441740 19:28284638-28284660 TAGAGGGAAAAGAGGGTGGAGGG + Intergenic
1164484704 19:28645003-28645025 TAGTGGGAAAAGAGGAAACAAGG + Intergenic
1164492326 19:28726969-28726991 TAGTTGGAAAGGTGGGTCAGTGG + Intergenic
1165487667 19:36105158-36105180 AAGTGGGGAGGGAGGGTAGAAGG + Intergenic
1166265138 19:41676882-41676904 TAGTGGTAAAGGAAGTAAAAAGG + Intronic
1166642933 19:44510164-44510186 GAGATGGAAAGGAGTGTAAAGGG + Intronic
1166828531 19:45624615-45624637 TTGTGTGAAATGAGTGTAAATGG - Intronic
1167965037 19:53137335-53137357 TAGTGCCAAAGGAGGGAACACGG - Intronic
925606946 2:5669323-5669345 AAGAAGGAAAGGAGGGAAAAGGG + Intergenic
925931927 2:8714888-8714910 TACTGGTAAAGGAGGGGAAGGGG + Intergenic
927051791 2:19337407-19337429 TAGAGGGAAAGGAGGGGGAGGGG - Intergenic
927284553 2:21343202-21343224 TAGTAGGAGAGGAGAGTACATGG + Intergenic
927500470 2:23579577-23579599 AAGTGGGACTGGAGGGAAAAGGG - Intronic
927951680 2:27174466-27174488 CAGTGGGAGAGGAGGGGTAAGGG - Intergenic
928456724 2:31429046-31429068 TAGTGGGAAATGAGGCTGGAAGG - Intergenic
928680378 2:33695119-33695141 TTGCGGGAAAGGAGGGTCTAGGG + Intergenic
928874847 2:36025963-36025985 TAGTTGAAAAGGAAGGTTAATGG + Intergenic
928993088 2:37256225-37256247 TAGTGGGAGATGAGGCTAGAAGG + Intronic
929090499 2:38212152-38212174 TAGAGGGAAAGGGGTATAAATGG + Intergenic
929444475 2:41991890-41991912 AAGGGGGAAAGGAGGGAGAAGGG + Intergenic
929610412 2:43266768-43266790 TTGTGGGAAAGGAGGGCATGGGG + Intronic
929934887 2:46287044-46287066 TAGTGGGGCAGGAAGGGAAAAGG + Intergenic
931511446 2:63000179-63000201 AAGTAGGAAAGGAATGTAAAAGG + Intronic
933137790 2:78759128-78759150 AAGGGGGAATGGAGGGTGAAAGG - Intergenic
934105008 2:88687542-88687564 GAGTGAGAAAGGAGAGGAAATGG + Intergenic
935796438 2:106645642-106645664 GGGTGGGAAGGGAGGGGAAAAGG + Intergenic
936434760 2:112494841-112494863 TAGAGGGGAAGCAGGGGAAACGG - Intronic
936598144 2:113868968-113868990 TATTGGGAATGGAGGGCAAGTGG + Intergenic
937693701 2:124784334-124784356 TTGTGCTCAAGGAGGGTAAAAGG + Intronic
938235049 2:129699161-129699183 TTGTGGGAGGGGAGGGCAAAGGG + Intergenic
938287570 2:130130152-130130174 GAGGGGGAAAAGAGGGTAACAGG + Intergenic
938428024 2:131208707-131208729 GAGGGGGAAAAGAGGGTAACAGG - Intronic
938468933 2:131542719-131542741 GAGGGGGAAAAGAGGGTAACAGG - Intergenic
939047285 2:137264723-137264745 TAATGGGAAAAGAGAGTATAGGG - Intronic
939442801 2:142271745-142271767 TAGAGGGAAAGCTGGGAAAATGG - Intergenic
939854522 2:147342169-147342191 TAGTGGGAAATGGGTGAAAAGGG - Intergenic
942511011 2:176700837-176700859 TCATGGGAAAGGAGTATAAAAGG - Intergenic
942564601 2:177254003-177254025 TACTGAGATAGGAGAGTAAAGGG - Intronic
943201634 2:184834554-184834576 GAGAGAGAAAGGAAGGTAAAGGG - Intronic
943431871 2:187812976-187812998 TAGAGGGAAAGGGTGGGAAAGGG + Intergenic
943951762 2:194137988-194138010 CAGTGGAAAATGAGGCTAAATGG - Intergenic
943956393 2:194196895-194196917 TTTTGGGAAAGGAGGGGCAAGGG + Intergenic
945456170 2:210054792-210054814 AAGGGGGAAAGGAAGGGAAATGG + Intronic
945698091 2:213134327-213134349 TAGTGGGAAAGGAGATTGGAAGG - Intronic
945835067 2:214829950-214829972 TGGGAGGAAAGGAGGGGAAAAGG - Intergenic
947304876 2:228734467-228734489 TAGGGGGAATGGAGGGGAAATGG - Intergenic
947316205 2:228861964-228861986 TGGCGGGGCAGGAGGGTAAATGG + Intronic
947398694 2:229712466-229712488 TAGTGGGAATGGATGGGAGAAGG - Intronic
947628710 2:231637662-231637684 AAGTGGGGGAGGAGGGGAAAAGG + Intergenic
948311584 2:236991252-236991274 TAGCAGGAAATGAGGGGAAAGGG - Intergenic
1168990947 20:2095302-2095324 TCGTGTGAAAGGAGGGCCAATGG + Intergenic
1169011833 20:2257447-2257469 TAGAGGGAGAGGAGGTTAACAGG + Intergenic
1169409756 20:5357868-5357890 TGGTGAGGAAGGAGGGAAAATGG + Intergenic
1170463631 20:16602297-16602319 TAGTTGGAAAGGAGGAGAGATGG + Intergenic
1172113970 20:32563015-32563037 TGGAGGGGAAGGAGGGTAGAGGG + Intronic
1172113985 20:32563061-32563083 TGGAGGGGAAGGAGGGTGAAGGG + Intronic
1174211317 20:48880749-48880771 TACTAGGAAAGAAGGGCAAATGG + Intergenic
1174898733 20:54476352-54476374 GAGTGGGAAAAGAGGGGAACCGG - Intronic
1175359624 20:58398549-58398571 TATTGGGAGACGAGGGAAAATGG + Intronic
1175648710 20:60698024-60698046 CAGTGGTAAAGAAGGGTAAGTGG - Intergenic
1177046960 21:16182934-16182956 TAGGAGGAAGGGAGGGAAAAAGG - Intergenic
1177692050 21:24523121-24523143 AAGAGTGAAAGGAGGGCAAAGGG + Intergenic
1177839860 21:26223489-26223511 TATTGAGGAAGGAAGGTAAATGG - Intergenic
1177957026 21:27610994-27611016 TAAAGGGAAAGGATGGTAAGAGG - Intergenic
1180712658 22:17850075-17850097 TAGTGGGAAAGCAGGTGACATGG + Intronic
1181756300 22:25027445-25027467 CAGTGGGAAAACAGGGTAACAGG + Intronic
1182767501 22:32768939-32768961 AAGAGGGAAAGCAGGGTATATGG - Intronic
1182950928 22:34375130-34375152 TAATGGGAAAGTTGGATAAAGGG - Intergenic
1183102712 22:35593665-35593687 GAGAGGGAAAGGAGAGAAAAGGG + Intergenic
1183615802 22:38944663-38944685 GAGAGGGGAAGGAGGGCAAAAGG - Intergenic
1184096712 22:42320016-42320038 TGGTGGGAATGGAGGGAAGATGG - Intronic
1184940415 22:47760793-47760815 TACTGTGAAGGGAGGGTGAAGGG + Intergenic
950602382 3:14046007-14046029 TAGTGGGAAAGGTGGTCTAAAGG + Intronic
953286154 3:41611870-41611892 TGGTAGGAAATGAGGGTAAAGGG - Intronic
954290576 3:49647854-49647876 GAGTGGGGAAGAAGGGTACAGGG - Intronic
954554262 3:51505816-51505838 TAGTGGGTGAGGAGGGTTATTGG + Intergenic
954897855 3:53992222-53992244 CAGCTGCAAAGGAGGGTAAAAGG + Intergenic
955281716 3:57600426-57600448 AAGGGGGAAGGGAGGGGAAAAGG - Intergenic
955552175 3:60096635-60096657 TTGTGAGAAAGGAAGGTACAGGG - Intronic
956524486 3:70142531-70142553 TAGGGGGAAAGGGTGGGAAAGGG + Intergenic
956644622 3:71443892-71443914 TATTGGGAGAGAAGGGTAAAAGG - Intronic
956932821 3:74064999-74065021 TAATGGGAAACGCAGGTAAAGGG + Intergenic
957205050 3:77186023-77186045 TAGGGGGAAAGGATGGAAAGGGG + Intronic
957701482 3:83720906-83720928 TACTTGGAAAGCAGAGTAAAAGG + Intergenic
958552449 3:95634662-95634684 TAGTGGAAAAAGAAGGTAGAAGG - Intergenic
959951529 3:112185069-112185091 TAGTGGGACAGGAGGGCCAGGGG + Intronic
960321527 3:116242540-116242562 TAGTGGGAAAGCAGGGGACCCGG - Intronic
961319489 3:126063111-126063133 CAGTGGGAATGGAGGGTCACAGG - Intronic
961444807 3:126974802-126974824 TACTGTGAAAGGAGGGCCAAAGG - Intergenic
961632328 3:128310280-128310302 CAGAGGGAAAGGAGAGAAAAAGG - Intronic
962865910 3:139447974-139447996 AGATGGGAAAGGAGGGGAAAGGG - Intergenic
962942076 3:140134232-140134254 TAGGGGGAGAGGAGGGATAAAGG - Intronic
962960319 3:140305345-140305367 TAATGGGAATGGAGTTTAAAGGG - Intronic
963121541 3:141780849-141780871 GAGTTGGAAAGGAGGGGAGAGGG + Intronic
963328592 3:143889563-143889585 GACTGGGAAAGCAGGATAAAAGG + Intergenic
963929827 3:150991965-150991987 TGGTTGGGAAGGAGGGTAGATGG + Intergenic
964939798 3:162143901-162143923 AAGTGGGAGAGGAAGGCAAATGG - Intergenic
965705194 3:171499692-171499714 TAGAGAGCATGGAGGGTAAAGGG - Intergenic
965932351 3:174060442-174060464 TACTGTTCAAGGAGGGTAAAGGG - Intronic
966025663 3:175277782-175277804 TCCTGAGATAGGAGGGTAAATGG - Intronic
966431257 3:179833172-179833194 CAGTGGGAATGGAGAGGAAAGGG + Intronic
966855816 3:184193267-184193289 TACTGGGCAAGAAGGGGAAATGG - Intronic
966989277 3:185212429-185212451 GAGTGGGAAGGGAGTGTAGAAGG - Intronic
967657147 3:192063915-192063937 TACTGGGAAAAAAGGATAAAAGG - Intergenic
967812370 3:193771621-193771643 TTGTTGGAAAGGATGATAAAAGG - Intergenic
968208822 3:196829292-196829314 AAGGGGGAAAGGAGGGAAGAAGG - Exonic
968931153 4:3580208-3580230 TAGAGAGAAGGGAGAGTAAAGGG - Intronic
969624437 4:8295163-8295185 TAGAGGGACAGGTGGGTAGACGG - Intronic
970105318 4:12575992-12576014 TAGTGGAAAAGGAGAGAAAAGGG + Intergenic
970737015 4:19183279-19183301 TTGTGGAAAAGCATGGTAAATGG + Intergenic
971998295 4:33995277-33995299 TATTGGGAAAAAAGGGGAAAAGG - Intergenic
972102215 4:35435085-35435107 TAGTGGGAAAGAAGGTAATATGG - Intergenic
974461287 4:62191409-62191431 CAGTTGGAAAGGTTGGTAAAAGG + Intergenic
975957539 4:79859269-79859291 GAGTGGGAAAGGAGGTGAGAGGG - Intergenic
976020812 4:80623173-80623195 GAGAGAGAAAGGAGGGGAAAGGG + Intronic
976326634 4:83779247-83779269 TGGGGGGAAGGGAGGGGAAATGG - Intergenic
977086847 4:92610545-92610567 AAGTGGAAAAGGAGGGGGAAGGG - Intronic
977471691 4:97451370-97451392 TATTGAGAAAGGAAGGGAAAAGG + Intronic
977978459 4:103294839-103294861 TAGTGGGAAAAAAGGGTACAAGG - Intergenic
978682014 4:111392707-111392729 TAGTGGGAAAGGAGACTCCAGGG + Intergenic
978947632 4:114516960-114516982 AAGGGGGAAAGGTGGGGAAAAGG + Intergenic
979255303 4:118602018-118602040 AAGGAGGAAAGGAGGGAAAAAGG - Intergenic
979676654 4:123416661-123416683 AAGTAGGAAAGAAGGGTGAAAGG - Intergenic
980229387 4:130029522-130029544 TAGTGGGAAAAGTGGATAATGGG + Intergenic
982364628 4:154562151-154562173 TTGTGGGAAATGAAGGAAAATGG + Intergenic
982476075 4:155852719-155852741 GGTTGGAAAAGGAGGGTAAAAGG - Intronic
982818408 4:159916069-159916091 TAATGGGAGAGGAGGTTGAAGGG + Intergenic
984418716 4:179492546-179492568 TAAAGGGAAAGGAAGGGAAAGGG - Intergenic
985756654 5:1723490-1723512 GAGAGGGAGAGGAGGGGAAAGGG - Intergenic
986975363 5:13387787-13387809 CAGAGGGATAGGAGGGAAAATGG + Intergenic
987728088 5:21729117-21729139 TAGTGGGAAAGCAGAGGAAGAGG + Intergenic
987979534 5:25064022-25064044 TAGTAGGAATGGAGGGTCAGAGG - Intergenic
988426661 5:31072969-31072991 TAGATGGATAGGATGGTAAAGGG - Intergenic
989446209 5:41532455-41532477 TAAAGGGAAAGGGGGGAAAAAGG + Intergenic
991054846 5:62308763-62308785 TGGTGGGGAAGGAGAGGAAATGG + Intronic
991252054 5:64574067-64574089 TAATCTAAAAGGAGGGTAAAGGG - Intronic
991693161 5:69245281-69245303 GAGGGGGAAGGGAGGGGAAAAGG - Intronic
992029312 5:72705213-72705235 GGGTGGGGAGGGAGGGTAAAGGG + Intergenic
992197701 5:74356114-74356136 TAGTGAGACAGTAGGGGAAATGG + Intergenic
993735069 5:91466515-91466537 AAGAGGGAAAGAAGGGAAAAAGG - Intergenic
994807329 5:104466340-104466362 TAGTGGAAAAGGATGATGAAAGG + Intergenic
995131767 5:108638079-108638101 TAGGGGGGAAGGAGGGAACATGG + Intergenic
996201992 5:120686558-120686580 TAGTGGGAAAGGAGGGAGATGGG - Exonic
996209167 5:120783853-120783875 TAGTGGGAATGGGGGGAAAAAGG - Intergenic
996302972 5:122009976-122009998 TAGTGGGAAGGGAAGGTTAAAGG - Intronic
996695105 5:126385759-126385781 TACTGGGAAAGTAGAGTAGAAGG + Intronic
997006237 5:129819735-129819757 TACTGGCAAATGAGGGCAAAGGG - Intergenic
997744096 5:136283644-136283666 TTGTGAGAAAGGAGGTGAAAAGG + Intronic
999229919 5:150055769-150055791 CAGTGACAAAGGAGGGTAACAGG + Intronic
1000322315 5:160144328-160144350 TAGTGGGATTGGTGGGTGAATGG + Intergenic
1000429708 5:161136580-161136602 TGCTGGGAAAGGAAGGAAAAAGG - Intergenic
1000545910 5:162601949-162601971 TACTGGAAGAGGAGGGGAAAGGG + Intergenic
1000849098 5:166318007-166318029 GAGTTGGAAAGGAGGGGAGAGGG - Intergenic
1001545979 5:172570794-172570816 AGGAGGGAAAGGAGGGGAAAAGG + Intergenic
1001558744 5:172655339-172655361 GAGGGGGAAAGGAGGGAAACAGG - Intronic
1002733208 5:181358638-181358660 CAGAGGGAAAGGAGTTTAAAGGG - Intergenic
1002751331 6:115469-115491 CAGAGGGAAAGGAGTTTAAAGGG + Intergenic
1003241748 6:4351212-4351234 TGCTGGGGAAGGAGGGGAAATGG - Intergenic
1003477614 6:6498549-6498571 GAGTGGGAGTGGAGGATAAAGGG - Intergenic
1004126770 6:12881838-12881860 GAGTGAGAAAGAAGGGCAAAAGG + Intronic
1004723993 6:18293495-18293517 TAATGGCAAAGGAGTGAAAAGGG + Intergenic
1005064781 6:21807642-21807664 TAGTGGGCAAGAAGAGAAAAGGG - Intergenic
1006668119 6:35712408-35712430 AAGGGGGTAAGGAGGGTAAGGGG + Intronic
1006706459 6:36025086-36025108 TAGGGTGGGAGGAGGGTAAAGGG - Intergenic
1007118678 6:39362544-39362566 TGGTGAGAAAGAAGGGTAAAAGG + Intronic
1007492791 6:42236977-42236999 TAGAGTGAAAGGAGAGAAAATGG + Intronic
1007837640 6:44686510-44686532 CAGTGGGAAAGGAGGGAAGGGGG - Intergenic
1009620672 6:66072013-66072035 TACTAGGAAAGGAGGGAGAAAGG + Intergenic
1010009126 6:71029430-71029452 TGGGGGCAAAGGAGGGAAAATGG - Intergenic
1010145643 6:72665949-72665971 TAGTGAGTAAGGTGGGTAACAGG - Intronic
1011000790 6:82586029-82586051 GAGTGGGAAAGGATGGTACTTGG - Intergenic
1011215748 6:85004001-85004023 AAGTGGGAAAAGGGAGTAAAGGG - Intergenic
1012353970 6:98290226-98290248 TAGTGGGAAATGAGGGATTAAGG + Intergenic
1013273781 6:108564313-108564335 TAGTGGAAGAAGAGGGAAAAGGG + Intronic
1013434688 6:110091310-110091332 CAATTGGAAAGGAGGGAAAAAGG - Intergenic
1014951589 6:127562161-127562183 TGGTGGGAAGGGAGGGAATAGGG + Intronic
1015705652 6:136084970-136084992 TAGAGGGAAAGAGGGGTGAAGGG - Intronic
1017370546 6:153701134-153701156 TAGTGGGAAAGGGGTGTCTAAGG + Intergenic
1017972651 6:159326743-159326765 TAGTGGGAAAGGAGGAGAAGAGG + Intergenic
1018033860 6:159865619-159865641 CACTGGGCAAGGAGGGGAAAGGG + Intergenic
1018682896 6:166279731-166279753 TAATGGAAAAGGATGGTCAAAGG - Intergenic
1018737736 6:166701306-166701328 TACTGGAAAAGGAGGCAAAACGG - Intronic
1019184052 6:170210609-170210631 TGGTGGGAAAGGAGAGTGAAGGG + Intergenic
1019237458 6:170630960-170630982 CAGAGGGAAAGGAGTTTAAAGGG - Intergenic
1021439768 7:20664708-20664730 TGGTGGGTAAGAAGAGTAAATGG - Intronic
1021700338 7:23313521-23313543 TATTGGAAAAGGAGGCAAAACGG - Exonic
1021717368 7:23471490-23471512 AAGTGGGAAAAGTCGGTAAAGGG + Intergenic
1022162998 7:27730859-27730881 CAGTGTGAAGGGATGGTAAAGGG + Intergenic
1022561023 7:31349649-31349671 TAGTGGTTAAGGATGGCAAATGG + Intergenic
1022955978 7:35380723-35380745 TAGTGGGAATGTGGGGTCAAAGG + Intergenic
1023641642 7:42264896-42264918 GAGTGAGAAAGGTGGGTGAAGGG + Intergenic
1024407824 7:49002824-49002846 GAGTGTTAAAGCAGGGTAAATGG - Intergenic
1025155121 7:56598112-56598134 TATTGGAAAAGGAGGCAAAACGG + Intergenic
1026104556 7:67410570-67410592 TAGTGGGAGAGGGTGGGAAAGGG + Intergenic
1026337126 7:69404145-69404167 CAGGGGGAAAGGATGGGAAAGGG + Intergenic
1026471751 7:70699865-70699887 TTGTGAGAAAGGAGGGTGATGGG + Intronic
1026852681 7:73734993-73735015 TGCTGGGAAGGGAGGGCAAAGGG + Intergenic
1028135995 7:87223479-87223501 TAATTGGAAAGGAGGAGAAATGG - Intergenic
1029032414 7:97482842-97482864 TAGTGGGAAAAGAAGGTTGAAGG - Intergenic
1029380369 7:100210278-100210300 TAGTGGAGAAGGGGGGTAATGGG + Intronic
1031003433 7:116444611-116444633 TAGTGGGAATTGAGAGGAAAAGG - Intronic
1031068509 7:117135095-117135117 CAGTGGGGAAGGAGAGTGAAAGG + Intronic
1031954575 7:127929382-127929404 CAGGGGGAAAGGAGGGTATGTGG - Intronic
1032308043 7:130755173-130755195 AGGTGGGAATGGAGGGGAAATGG - Intergenic
1032842876 7:135727740-135727762 AACTGGGAAAGGATGATAAACGG + Exonic
1033414034 7:141146791-141146813 GGGTGGGAAAGGATGGTAGAAGG - Intronic
1033457058 7:141512095-141512117 TGGAGGGAAAGGAGGGAAAGCGG - Intergenic
1034550132 7:151815171-151815193 TTGGGGGAATGGAGTGTAAATGG - Intronic
1035413794 7:158667396-158667418 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413804 7:158667425-158667447 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413934 7:158667800-158667822 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413955 7:158667859-158667881 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413965 7:158667888-158667910 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414003 7:158668002-158668024 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414024 7:158668061-158668083 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414034 7:158668090-158668112 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414086 7:158668233-158668255 TAGTGGGTAAGGAGGGCAGAGGG - Intronic
1035414124 7:158668350-158668372 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035510309 8:175651-175673 CAGAGGGAAAGGAGTTTAAAGGG + Intergenic
1036635527 8:10547654-10547676 GAGTGGGAAGGGAAGGGAAAAGG - Intronic
1037268391 8:17095718-17095740 AAGGAGGAAAGGAGGGAAAAAGG - Intronic
1037569918 8:20149407-20149429 AAGTGGGAAAGGAGAGGAAGAGG - Intronic
1038063096 8:23934208-23934230 GACTGGGAAAGGAGCGGAAATGG - Intergenic
1038373510 8:27015194-27015216 TAGTGGGAAGGAAGGAGAAAGGG + Intergenic
1038392310 8:27213729-27213751 GAGAGGGAAAGGAAGGAAAAAGG + Intergenic
1038486021 8:27935763-27935785 TAGGGGGAGAGCAGGGTAAGTGG + Intronic
1039386245 8:37138174-37138196 TTGGGGGAAAGGAGGGTGCAGGG + Intergenic
1040057318 8:43070420-43070442 TAATGGGAAAAGAGATTAAATGG + Intronic
1040278869 8:46027632-46027654 TTGAGAGAAAGGTGGGTAAATGG - Intergenic
1040439398 8:47425215-47425237 TAGTGGGAAGTGAGGGTCACAGG + Intronic
1040482618 8:47840515-47840537 AAGGGGGAAAGTTGGGTAAAGGG + Intronic
1040896367 8:52373159-52373181 TTCTGGGAAAGGAGGGGAAGGGG + Intronic
1041755136 8:61305314-61305336 GAGTGGGAAGGGAGGATGAAGGG - Intronic
1042186153 8:66138199-66138221 GAGTGGGAAATGAGGATAACGGG - Intronic
1042523020 8:69734248-69734270 TAGTGGCAAAGGAGGGTGGAGGG - Intronic
1042795885 8:72662753-72662775 GAGTGGGACAGGAGGGCTAATGG + Intronic
1042901500 8:73732808-73732830 TGGTGGGAAAGGAGGGCAGACGG - Intronic
1043597605 8:81902998-81903020 AAGGGGGAATGGAGGGTAGAAGG + Intergenic
1043743740 8:83846592-83846614 TAGTGCCGAAGGAGGGTTAAAGG + Intergenic
1044255899 8:90060747-90060769 TAGTGGGAAATGAAGTAAAATGG + Intronic
1044462053 8:92457191-92457213 GGGTGGGAAGGGAGGGGAAAAGG + Intergenic
1044512382 8:93097358-93097380 CAGTGGCAAAGGAGGGAGAAAGG + Intergenic
1044804151 8:95987730-95987752 TTGTGGGGAAGGAGGGTCTATGG - Intergenic
1045404675 8:101853846-101853868 TTGGTGGAAAGGAGAGTAAATGG - Intronic
1046617643 8:116495080-116495102 CAGTGGGAGAAGAGGGTACAAGG - Intergenic
1047461156 8:125066693-125066715 TAGTGTGAAATGAGGCTGAAAGG - Intronic
1047987349 8:130248633-130248655 TGGTGGAAATGGAAGGTAAAGGG + Intronic
1048875545 8:138834399-138834421 TAGTGGTAAAAGAGGCTAAGAGG - Intronic
1049241858 8:141541856-141541878 TGGTGGGACAGGAGGGCAGAGGG - Intergenic
1050255906 9:3791581-3791603 TATTGGGAAAGGTGGGAACAAGG - Intergenic
1052518917 9:29518177-29518199 GAGTGGGAAGGGAGGGGAGATGG - Intergenic
1053047479 9:34931870-34931892 AAGTGGGAAAAGAGGGCAAGAGG + Intergenic
1054458980 9:65451769-65451791 TAGAGAGAAGGGAGAGTAAAGGG + Intergenic
1055335000 9:75224460-75224482 CAGGGGGAAAGGAGGGGAAGGGG - Intergenic
1056831484 9:89920666-89920688 AAGTGGGGAAGTGGGGTAAAAGG - Intergenic
1058913175 9:109539960-109539982 TAGTGGGAGAGGAAGAGAAAGGG + Intergenic
1060188572 9:121578358-121578380 TAGGGGGAGAGGAGGGAAGAGGG - Intronic
1060465441 9:123900460-123900482 AAGTGCGGCAGGAGGGTAAAGGG + Intronic
1062757613 9:138310961-138310983 CAGAGGGAAAGGAGTTTAAAGGG - Intergenic
1186301336 X:8202935-8202957 TAGTGGGGATGGAGAGTATATGG - Intergenic
1186463864 X:9769317-9769339 AAGTGGGAATGGTGGGTAAATGG - Intronic
1187514775 X:19959065-19959087 TAGAGGGAAAGGAGACTGAAAGG - Intronic
1187625599 X:21109542-21109564 TTGAAGGAAAGGAGGGTATAGGG + Intergenic
1188034291 X:25299311-25299333 TAGTGTGAAAGGCGAGTACAAGG + Intergenic
1188267132 X:28091100-28091122 AAGTGGGAGAGGAGGCAAAAAGG - Intergenic
1188463522 X:30453522-30453544 AAGGGGGAATGGAGGGTAGAAGG + Intergenic
1189237239 X:39496492-39496514 TAGGGGCAAAGCAGAGTAAAGGG + Intergenic
1190324004 X:49195527-49195549 CAGAAAGAAAGGAGGGTAAAGGG + Intronic
1190502635 X:51095138-51095160 GAGAGAGAAAGGAGGGGAAAAGG - Intergenic
1190787939 X:53671123-53671145 CAGGGGGAAAGGATGGGAAAGGG + Intronic
1190821240 X:53974913-53974935 TGGTGGGGAAGGAGAGTACAAGG + Intronic
1190876385 X:54463124-54463146 GAGTGTAAAAGGAGGGGAAAGGG - Intronic
1191720262 X:64223172-64223194 TGGTGGGAAGGCAGGGAAAATGG + Intergenic
1191960767 X:66699342-66699364 CAGTGGGAAAGGATGGAAATGGG - Intergenic
1192623765 X:72706781-72706803 TAGTGGGGCTAGAGGGTAAAGGG - Intronic
1192774141 X:74224035-74224057 AAATGGGAAAGGAGGTCAAACGG + Intergenic
1192848051 X:74925725-74925747 TGGTGGGGAAGAAGGGTAGAGGG - Intergenic
1193302927 X:79913827-79913849 TAGTGGGATTGGAGGGTCATAGG - Intergenic
1193379878 X:80806969-80806991 AAGTGGCAAAGGAGATTAAAAGG - Intronic
1194792446 X:98167739-98167761 CAGTGGGAGAGGATGGTGAAAGG + Intergenic
1195345891 X:103950893-103950915 TAGTGGGAAAGGAGAGTGGCTGG + Intronic
1195926580 X:110031758-110031780 TAGGGGGAAAGGAGGGATTAGGG - Intronic
1195953493 X:110303546-110303568 TAATGGGATAGGAGGCCAAATGG - Intronic
1195958537 X:110360810-110360832 CAGTGGGAATGGAAGGAAAATGG + Intronic
1196218340 X:113081845-113081867 CAGTGGGAAAGGGTGGGAAAAGG - Intergenic
1197705470 X:129631534-129631556 GAGTGGAAGAGGAGGGTACAGGG + Intergenic
1198097364 X:133393110-133393132 AAGTGGGAGAGGAGGGAGAATGG + Intronic
1198683190 X:139203525-139203547 TGGTGGGAAAGGAGGGGGGAGGG + Intronic
1199664071 X:150082741-150082763 GATTGGGAAAGATGGGTAAAAGG + Intergenic
1199925314 X:152456680-152456702 TAGTGGGGAGGGATGGTTAATGG + Intergenic