ID: 1117485491

View in Genome Browser
Species Human (GRCh38)
Location 14:56192691-56192713
Sequence GTGAGCGATGAGAAAACTGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 167
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 149}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117485491 Original CRISPR GTGAGCGATGAGAAAACTGC GGG (reversed) Intronic
902251451 1:15156258-15156280 GTGAGGGATGGGAAAGCTGGAGG + Intronic
904254628 1:29247038-29247060 GTGAGTGAAGAAGAAACTGCAGG - Intronic
904402635 1:30266905-30266927 TTGAGAGATGAGGAAACTGAAGG + Intergenic
905421808 1:37851895-37851917 GTGAGTGATGAGGAAACAGGAGG - Intronic
906794017 1:48682348-48682370 TTTACCGATGAGAAAACTGAGGG - Intronic
906943505 1:50276128-50276150 CTGATAGATGAGAAAACTGATGG + Intergenic
909577830 1:77195193-77195215 GTGGGCGATGAGAAAGGTGCTGG + Intronic
910840798 1:91559532-91559554 GTGCGGGATGAGAAATGTGCGGG + Intergenic
911224179 1:95286661-95286683 GTGAGAGATCAGGAAACAGCGGG + Intergenic
913207252 1:116551446-116551468 GAGAGAGGTGAGAAAGCTGCAGG - Intronic
919937297 1:202262873-202262895 GTGAGATATGGGAAGACTGCAGG - Intronic
922108152 1:222530378-222530400 GTGAGTGACGTGAAAGCTGCAGG - Intronic
922173803 1:223179125-223179147 GTGAGAGAGGAGACAACTCCAGG + Intergenic
924598200 1:245465342-245465364 GTGAGAGATGAGGGAGCTGCTGG + Intronic
924677782 1:246197973-246197995 GTGGGCTAGGATAAAACTGCTGG + Intronic
1063803997 10:9616438-9616460 GAGAGAGGTGAGAAAGCTGCAGG - Intergenic
1070391775 10:75977239-75977261 TTGAGCTATGAGTAAATTGCTGG - Intronic
1070820571 10:79351751-79351773 CTGAGAGATGAGAAAACTCTAGG - Intronic
1072918370 10:99554706-99554728 GTGGGTGATGGGAAAGCTGCGGG + Intergenic
1074355882 10:112782664-112782686 GTGTCCGATGAGAAGTCTGCAGG - Intronic
1075457252 10:122592847-122592869 GAGGCCGAAGAGAAAACTGCTGG + Intronic
1078024586 11:7682668-7682690 AGGAGCAAAGAGAAAACTGCTGG - Intergenic
1078441753 11:11373908-11373930 CTCAGGGATGAGAAAACTGTCGG + Intronic
1080006407 11:27412348-27412370 GTGAGCCAGCAGAAAACTGAGGG - Intronic
1080305241 11:30828118-30828140 GTGAGTGAGGAGAAGACAGCAGG - Intergenic
1080504492 11:32898999-32899021 GTGAGGGTTGAAAATACTGCAGG - Intronic
1080599495 11:33808519-33808541 ATGAGCTTTTAGAAAACTGCAGG + Intergenic
1085351353 11:75799987-75800009 GTGACAGATGAGGAAACTGAGGG + Intronic
1085571070 11:77558524-77558546 GTGAGTAATGGGGAAACTGCTGG - Intronic
1087563386 11:99819921-99819943 GTGAGCTAGTAGAAAACTGGAGG + Intronic
1088521421 11:110705266-110705288 GGGAGAGCTGAGAAAACTGATGG - Intronic
1088951852 11:114579681-114579703 TTGACAGATGAGAAAACTGAGGG + Intronic
1089434531 11:118453011-118453033 AGGAGAGATGAGATAACTGCAGG - Intronic
1092601725 12:10073486-10073508 GTGTGCTTTGAGAAAAGTGCTGG - Intronic
1092822062 12:12362013-12362035 GTGAGGGAGGAGAGAACTGAAGG - Intronic
1093195901 12:16129323-16129345 ATTAGCAATGGGAAAACTGCAGG + Intergenic
1093409537 12:18847842-18847864 GTTAGACATGAGAAAACTGAGGG + Intergenic
1095772440 12:45975766-45975788 GGGAGAGATGAGAGAACAGCTGG + Intronic
1096211251 12:49767605-49767627 GTGGGCCATGAGACAACAGCAGG + Intergenic
1096574374 12:52543497-52543519 CTGAGCGGTGAGAAAAGGGCTGG + Intergenic
1096906267 12:54939013-54939035 GAGAGAGGTGAGGAAACTGCAGG + Intergenic
1097251255 12:57633222-57633244 GTGGGCGCGGAGGAAACTGCGGG + Exonic
1099245325 12:80187165-80187187 GTAAGGGATGAGAAAACAACAGG + Intergenic
1102735320 12:115153979-115154001 TTTAGAGATGAGAAAACTGAGGG - Intergenic
1103889110 12:124225213-124225235 GTGTGCGATGAGCATGCTGCAGG + Intronic
1104906252 12:132214987-132215009 GTGAGAGTGGAGAAACCTGCCGG + Intronic
1105554837 13:21437161-21437183 GAGAGAGATGAGAAAGCTGCAGG + Intronic
1105811986 13:24003337-24003359 CTGAGCCATGAGATAACAGCAGG + Intronic
1106457348 13:29938668-29938690 GTGAGCACTCAGAAAAATGCTGG - Intergenic
1106706658 13:32287741-32287763 GTGAGCAATGCTAATACTGCTGG + Intronic
1107177897 13:37421360-37421382 CTGAGGGATAAGAAAACTGGAGG + Intergenic
1107561065 13:41558116-41558138 ATGAGAGATGAGAAAACAACTGG - Intergenic
1107768379 13:43762261-43762283 GGGAGCAATGGGAAAACTGGAGG - Intronic
1109236563 13:59828597-59828619 GTGACAGGTGAGATAACTGCAGG - Intronic
1110950246 13:81478494-81478516 GTGAACAAAGAGAAAGCTGCTGG + Intergenic
1113304399 13:109061096-109061118 GAGAGAGGTGAGGAAACTGCAGG - Intronic
1116424364 14:44771562-44771584 GAGAGAGAAGAGAAAACTGTAGG - Intergenic
1117321986 14:54633349-54633371 GTGAGTGAGGAGGAGACTGCAGG + Intronic
1117485491 14:56192691-56192713 GTGAGCGATGAGAAAACTGCGGG - Intronic
1117932349 14:60856395-60856417 GAGAGAGGTGAGAAAGCTGCAGG + Intronic
1118717871 14:68573166-68573188 GTGAGTGAGGTGAGAACTGCTGG - Intronic
1119526495 14:75326822-75326844 TTGAGAGAGGAGAAAACTGAGGG - Intergenic
1125119006 15:36130483-36130505 GTTAGAGATGAGAAAAATGAAGG + Intergenic
1129596253 15:76966780-76966802 GTGAGCCATGAAAAAACAGTTGG + Intergenic
1137567316 16:49541477-49541499 GTGTGCGCTGAGAAACTTGCTGG + Intronic
1138216633 16:55210484-55210506 TTGAGTGATGAGATAGCTGCGGG - Intergenic
1140702955 16:77599323-77599345 GAGACAGATGAGAAAACTGTAGG + Intergenic
1143196727 17:5081539-5081561 GTGAGAGAAGAGAAACCTACAGG - Intronic
1144174708 17:12694042-12694064 GTGAATGAAGAGAAAACTCCAGG + Intronic
1144512050 17:15885817-15885839 CTGAGAGATGAGAAAACTAAAGG + Intergenic
1147487194 17:40827845-40827867 GTGAGGGAGGAGAAAATGGCTGG + Intronic
1147782238 17:42951851-42951873 GTGGGCGATGAGAAAGGTGGTGG - Exonic
1152436228 17:80278109-80278131 GTGAGGGAAGAGGAGACTGCCGG + Intronic
1156016990 18:32557923-32557945 GAGAGGGAGGAGAAAACTGAAGG - Intergenic
1158144773 18:54299620-54299642 GTGAGCTATGAGACAACTTCAGG + Intronic
1159900148 18:74038020-74038042 GGCAGTGATGAGAACACTGCAGG - Intergenic
1162712238 19:12604031-12604053 GGGAGGGAAGAGAAAACTGAAGG + Intronic
1163105074 19:15118668-15118690 GTGAAGGATGAGAAAACTATGGG - Intronic
1164473205 19:28552973-28552995 GTGATCGATGGGGAAACTGAGGG - Intergenic
1168165825 19:54546911-54546933 GTGAGCTAAGAGACAAATGCTGG + Intergenic
925360077 2:3272536-3272558 GAGAGAGATGAGGAAACTGCCGG + Intronic
925717299 2:6796242-6796264 GGGAGCGAGGAGTAAAATGCTGG + Intergenic
928572916 2:32626993-32627015 AAGAGCCAGGAGAAAACTGCAGG - Intergenic
935176128 2:100650186-100650208 GAGAGAGATGAGGAAGCTGCAGG + Intergenic
935614647 2:105064579-105064601 GTGAGCGATGTGGAAGCTGAAGG + Intronic
938406124 2:131034271-131034293 CTGAGAGATAAGAAGACTGCAGG - Intronic
938709916 2:133967376-133967398 GTGAGCTATGAAACACCTGCTGG - Intergenic
942636496 2:178012478-178012500 TTGACAGATGAGAAAACTTCAGG + Intronic
945542069 2:211100417-211100439 GTGAGAGAAGAGAAAACTAAGGG + Intergenic
946462138 2:219878052-219878074 GCAAGGGACGAGAAAACTGCTGG + Intergenic
947226584 2:227846332-227846354 GTGAGCTATGATCACACTGCTGG - Intergenic
1170293467 20:14797383-14797405 GTGAGCCAGGAGAGAACTGCAGG - Intronic
1172545415 20:35757091-35757113 GTAAGTGTTGAAAAAACTGCTGG - Intergenic
1172592193 20:36125724-36125746 GAGAGCGATGAAGACACTGCAGG + Intronic
1173154971 20:40601046-40601068 GTGAGCCATGAGAGAACTGGTGG - Intergenic
1174789677 20:53465687-53465709 TTGAGAGATCAGAAAACTGAGGG - Intronic
1175467780 20:59204080-59204102 ATGAGCGAGGAGAAGATTGCAGG + Intronic
1178925761 21:36773619-36773641 GTCAGAGCTGAGAAAACTGGGGG - Intronic
1181683139 22:24509827-24509849 GTGAATGATGAGAAAAGTTCTGG - Intronic
1181850720 22:25748131-25748153 GTGACAGATGAGAAAACTGGGGG + Intronic
1185401334 22:50619464-50619486 GGGAGAGATGAGAAAGCTGCAGG - Intergenic
952559183 3:34569665-34569687 GTGAGCTAGGGGAAAAGTGCTGG - Intergenic
953363915 3:42325467-42325489 GTGGGCGAGGAGAAAACAGGAGG - Intergenic
954516471 3:51182241-51182263 GTTAACGATGAGAAAACTGAGGG - Intronic
955000540 3:54923376-54923398 ATGAGCCATGAGATAACTGGGGG - Intronic
955444422 3:58994275-58994297 GTGAGCAATGAGAGCACTGCAGG - Intronic
957724463 3:84046420-84046442 TTGAGAGATGAGGAGACTGCTGG + Intergenic
958795013 3:98698086-98698108 GGGAACAATTAGAAAACTGCAGG + Intergenic
959385000 3:105693099-105693121 GTGAGAAATGAGAAACCTGGTGG + Intronic
959852322 3:111103514-111103536 GTGGGTGATGAAAAAACTCCTGG - Intronic
960401560 3:117205780-117205802 GAGAGCGGTGAGGAAGCTGCAGG + Intergenic
961092148 3:124122719-124122741 GGGAGAGATGAGAAAACAGCTGG - Intronic
962164005 3:133029924-133029946 GTGAGAGATGGGGAACCTGCTGG - Intergenic
962902361 3:139772461-139772483 GTTAAGGATGAGAAGACTGCTGG + Intergenic
963411527 3:144933396-144933418 GTGAGCAATAAGAAATCTGATGG + Intergenic
964076230 3:152695660-152695682 GAGAGAGGTGAGAAAACTGCAGG + Intergenic
964076929 3:152703077-152703099 GTGAGAGATGAGAGAATGGCTGG + Intergenic
966658529 3:182387479-182387501 CTGAGAGATGAGAAAACTGAGGG - Intergenic
969199181 4:5588542-5588564 GTGAGCCATGAGACAACTTCAGG - Intronic
973224674 4:47769573-47769595 TTGAGCGAAAAGAAAACTGAAGG + Intronic
975472075 4:74781462-74781484 GTGAGCTATGAGGAAATTACTGG - Intronic
982339061 4:154274752-154274774 GTGAGAGATTAGAAAAATCCTGG + Intronic
982609591 4:157557187-157557209 GTGGGGGCTTAGAAAACTGCTGG - Intergenic
986631555 5:9778722-9778744 GAGAGAGGTGAGAAAACTACAGG - Intergenic
989143558 5:38226083-38226105 GTGAGCCATGATCAAACTTCTGG + Intergenic
990702193 5:58485671-58485693 GGGCTAGATGAGAAAACTGCTGG - Intergenic
999094660 5:148967142-148967164 AGGAGCCATTAGAAAACTGCTGG - Intronic
999927611 5:156396360-156396382 TGGAGTGATGAGAAAACTGCTGG + Intronic
1001433236 5:171680002-171680024 GTAAGAGATGAAAACACTGCAGG + Intergenic
1003050711 6:2778562-2778584 GGAAGCGACGAGAAGACTGCTGG - Intronic
1004084828 6:12436399-12436421 GTGAGAGATAACAAAACTGAAGG + Intergenic
1008761229 6:54853129-54853151 GAGAGAGATGAGAAAGCTGGAGG + Intronic
1011609423 6:89136018-89136040 GTGGGCAATAAGAATACTGCTGG + Intergenic
1012531396 6:100241807-100241829 GTTAGAGATGAGAAGACAGCAGG - Intergenic
1014182262 6:118398030-118398052 CTGGGCTATGAGAAATCTGCAGG - Intergenic
1016082431 6:139872108-139872130 GAGAGAGAGGAGAAAACTGAGGG + Intergenic
1016499477 6:144703238-144703260 TAGAGAGATAAGAAAACTGCTGG + Intronic
1016572276 6:145528088-145528110 GCAAGCGGTGAGAAAGCTGCAGG + Intronic
1017567867 6:155708423-155708445 GTGAGCTATGGACAAACTGCTGG - Intergenic
1018350700 6:162956029-162956051 GGGAGCAAAGAGAAAACAGCAGG - Intronic
1019038734 6:169084803-169084825 GTGAGCAGTGAGAAAGCTGTTGG - Intergenic
1021196342 7:17678677-17678699 GTGAGCGATGAGTTCAGTGCAGG + Intergenic
1023656053 7:42422122-42422144 GTGAGAGATCAGAAAAGAGCAGG - Intergenic
1023778440 7:43633311-43633333 GTGAGAGGTGAGGAAGCTGCAGG - Intronic
1028493574 7:91440601-91440623 GATAGAGATGAGAAAACTGTTGG + Intergenic
1029049970 7:97675424-97675446 GAGAGAGGTCAGAAAACTGCAGG + Intergenic
1029431110 7:100531117-100531139 GTGAGCTGTGAGACAACTTCAGG - Intergenic
1030483689 7:110138418-110138440 ATGAGAGATGGGGAAACTGCTGG - Intergenic
1031388356 7:121181136-121181158 GTGAGAGATGATCATACTGCAGG + Intronic
1031548185 7:123076404-123076426 GTGAGCTAACAGAAAACTACTGG - Intergenic
1033366322 7:140674570-140674592 GTGAGACAGGAGAAACCTGCTGG - Intronic
1038240941 8:25807570-25807592 GTGAGCGATTAGAAAGATGCAGG - Intergenic
1038743733 8:30237898-30237920 ATTATCGATGAGACAACTGCAGG + Intergenic
1042060052 8:64806737-64806759 GTTAGTGATTAGAAAGCTGCAGG - Intergenic
1045845555 8:106631318-106631340 GTGAGCTTTGAGAAAACCACAGG - Intronic
1046571712 8:115974518-115974540 GAGAGAGGTGAGGAAACTGCAGG - Intergenic
1046848068 8:118941074-118941096 TTTACAGATGAGAAAACTGCAGG - Intronic
1049131460 8:140847858-140847880 GTGAGAGATGAGTTAACTGGGGG - Intronic
1049559067 8:143298693-143298715 GTCAGTGATGAGAAAGCTGTAGG + Intergenic
1050905327 9:10996016-10996038 GTGAGCTATGGGCAAACTGCTGG + Intergenic
1053657079 9:40227834-40227856 GAGAGCGATCAGAAATATGCAGG + Intronic
1059514523 9:114880650-114880672 GAGAGCCATGAGAAAATTGTGGG + Intergenic
1060210515 9:121707340-121707362 CTGAGAGATGGGAAAACTGAGGG - Intronic
1060319310 9:122541052-122541074 GTGAGCTAGTAGAAAACTACTGG - Intergenic
1061644662 9:131990961-131990983 GGGTACGATGAGAAATCTGCGGG + Intronic
1187842583 X:23504481-23504503 GAGACAGATGGGAAAACTGCTGG - Intergenic
1198826599 X:140704937-140704959 GAGAGAGATGGGAAAACAGCAGG + Intergenic