ID: 1117487574

View in Genome Browser
Species Human (GRCh38)
Location 14:56213589-56213611
Sequence CATTGTAAAGAGAAGAATGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 438
Summary {0: 1, 1: 0, 2: 3, 3: 32, 4: 402}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117487572_1117487574 23 Left 1117487572 14:56213543-56213565 CCTGAAGCAGCATGTGGACTGTT 0: 1
1: 0
2: 2
3: 10
4: 169
Right 1117487574 14:56213589-56213611 CATTGTAAAGAGAAGAATGGTGG 0: 1
1: 0
2: 3
3: 32
4: 402

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117487574 Original CRISPR CATTGTAAAGAGAAGAATGG TGG Intronic
900471398 1:2856752-2856774 AAATGGAAAGAGAAGAAGGGAGG - Intergenic
900775856 1:4585113-4585135 CATTTTAGGGAGAAGAAGGGGGG + Intergenic
903845487 1:26277599-26277621 CATTGGATGGAGAAGAAAGGTGG - Exonic
903977372 1:27159677-27159699 CAGTGTAAAAAGAAGAAAAGAGG + Intronic
904793522 1:33041848-33041870 CATTTGAAAGAGAAAAAAGGAGG - Intronic
905011924 1:34753423-34753445 CATTGTAAACAGAAGCTTGCAGG + Intronic
905255306 1:36677925-36677947 TTTGGTACAGAGAAGAATGGAGG + Intergenic
905931777 1:41792972-41792994 CATTGGAAAGAGCAGAATCCAGG - Intronic
906178560 1:43798154-43798176 CATTGTGAAGACAGGAAAGGGGG - Intronic
906364672 1:45196695-45196717 GATTTTAAAGAAAAGAATTGTGG - Intronic
906391059 1:45416771-45416793 AAATGTGGAGAGAAGAATGGTGG - Intronic
906805386 1:48775653-48775675 CTTTGTAAAGAGAAGACAGCTGG - Intronic
907974600 1:59419256-59419278 CATTGTGAAAAGAATATTGGAGG + Intronic
908933644 1:69346880-69346902 TTTTGAAAAGAGAAGAAAGGAGG + Intergenic
909218098 1:72918011-72918033 CATAGTAGAGAGTAGAATGGTGG + Intergenic
909802285 1:79825320-79825342 CTATGCAAAGGGAAGAATGGAGG - Intergenic
911715683 1:101130195-101130217 CAATGTAAAGAGTAGACAGGAGG - Intergenic
911717513 1:101151015-101151037 CATTCAAAAGATAAGAATGTGGG - Intergenic
913032953 1:114930498-114930520 CATTAAAAAGATAAGAAAGGGGG + Intronic
913142432 1:115954884-115954906 CCTTGTAAAGAGCAAGATGGGGG + Intergenic
913419479 1:118649283-118649305 CATTGTCTAGAGAAGAATGAGGG - Intergenic
913579705 1:120213973-120213995 CAATGTGAAAAGAAGAATAGAGG + Intergenic
913628469 1:120684415-120684437 CAATGTGAAAAGAAGAATAGAGG - Intergenic
914260136 1:145992095-145992117 CATTTGAAAGAAAAGAGTGGCGG - Intergenic
914561639 1:148825400-148825422 CAATGTGAAAAGAAGAATAGAGG + Intronic
914611193 1:149304808-149304830 CAATGTGAAAAGAAGAATAGAGG - Intergenic
915436679 1:155911703-155911725 CAATGTAATGAGAGGAAGGGAGG + Intergenic
916585303 1:166144817-166144839 CATGGTAAAGAACAGAAAGGGGG - Intronic
917856917 1:179108580-179108602 AAGGGTAAAGAGAAGAATGGTGG - Exonic
917956529 1:180104996-180105018 TATTGTAAAGGGAAAATTGGAGG - Intronic
918315456 1:183319007-183319029 CATTGCAATGAGGAGAATGCAGG - Intronic
919094157 1:193009969-193009991 CATTTTTATGAGAAGAATCGTGG + Intergenic
919111228 1:193221177-193221199 CATTGAGAAGAGAAGATTGGAGG + Intronic
919556894 1:199067719-199067741 CATCGAAAAGAGTGGAATGGAGG - Intergenic
922666068 1:227470653-227470675 CATTTAAAAGAGAAGAAGAGTGG + Intergenic
923811777 1:237325978-237326000 CATAATAATGAGAAGGATGGTGG + Intronic
1062919283 10:1266828-1266850 CCTTGAAAAAGGAAGAATGGAGG + Intronic
1062942702 10:1435945-1435967 CATTGTCAAGAACAGAAAGGTGG - Intronic
1063658740 10:8017926-8017948 CATTGAAAGGAGAACAAAGGCGG - Intergenic
1063715274 10:8520679-8520701 CAATGCAAAAAGAATAATGGAGG - Intergenic
1065491451 10:26286195-26286217 AATTTTAAAAAAAAGAATGGGGG - Intronic
1065552397 10:26882062-26882084 CATTAAAAAAAGAAGAGTGGAGG - Intergenic
1065833487 10:29636350-29636372 CTCTGTAAAGAGAAGATAGGAGG + Intronic
1067927450 10:50524454-50524476 CACAGTCAAGAGAAGAAAGGAGG - Intronic
1071557871 10:86619838-86619860 CTGTGTCAAGAAAAGAATGGTGG + Intergenic
1074277577 10:112018842-112018864 TATTTTAAAGGGAAGAATGGGGG - Intergenic
1074389713 10:113046587-113046609 CATTTTGAAGAGAAGACTTGGGG - Intronic
1075631130 10:124001321-124001343 CATAGTAAGGAGACCAATGGTGG - Intergenic
1076141711 10:128084603-128084625 CATTGTACAGAGAAGGAGAGAGG - Exonic
1078543191 11:12228023-12228045 CATTTTACAGATAAAAATGGAGG + Intronic
1079334900 11:19562683-19562705 CATTGTGAAGAGAAAAATGAAGG + Intronic
1080847694 11:36040513-36040535 AATGATAAAGAGAAAAATGGGGG - Intronic
1081005285 11:37728632-37728654 CATTGTGAAGATAAGAAATGTGG + Intergenic
1083480194 11:62939294-62939316 CATTGCAAAGACAAAAATAGAGG - Intronic
1084078376 11:66800190-66800212 CATAGTAGAGAATAGAATGGTGG + Intronic
1086446251 11:86874101-86874123 CTTTGTGAAGAGAAGAATAAAGG + Intronic
1087077999 11:94143419-94143441 CACTGGAGATAGAAGAATGGAGG - Intronic
1087409180 11:97768622-97768644 CATTGCTAAGAGAACAATGAAGG - Intergenic
1087448480 11:98286363-98286385 GATTGAAAAGATAAAAATGGAGG + Intergenic
1087596983 11:100266646-100266668 CACTTTAAAGAGAGGAATGAAGG + Intronic
1087829229 11:102800850-102800872 CATTTAAAAGAGAATTATGGGGG - Intergenic
1088007424 11:104959951-104959973 CGTTGCAAAGAGTAGAATAGAGG - Intronic
1088182876 11:107132038-107132060 CATTTAAAAGATAAGAATGGTGG + Intergenic
1088254746 11:107892702-107892724 CATTGTAAAAAGCAGTATGAAGG + Intronic
1088372813 11:109110212-109110234 CATTTTAGAGAGGAGAATGGTGG + Intergenic
1090353792 11:126125548-126125570 ATTTGTAAAGTGAAGGATGGGGG - Intergenic
1091112383 11:132981901-132981923 CCTTGTAAGGAGAAAAATGAAGG + Intronic
1091247554 11:134111400-134111422 CATAGTTAAAAGATGAATGGTGG - Intronic
1091268066 11:134286231-134286253 AATTATAAAGAGAAGAATCGAGG + Intronic
1093516169 12:19989478-19989500 CATTTGTAAGAGAAGAATTGGGG + Intergenic
1094153959 12:27317752-27317774 GATTGTAAATTGATGAATGGTGG + Intronic
1094318282 12:29156037-29156059 AAAAGTAGAGAGAAGAATGGTGG + Intronic
1096379454 12:51143659-51143681 CATTTTAAAGAGAAGCATGGAGG + Intronic
1096438188 12:51613570-51613592 CATTGAAAACAGAAAAATAGAGG - Intronic
1096562901 12:52449725-52449747 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096565052 12:52471388-52471410 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096567064 12:52490825-52490847 CAGAGTAAACAGAAGGATGGTGG + Intronic
1099103805 12:78476812-78476834 CATTGTCAATAAAGGAATGGGGG - Intergenic
1099383019 12:81978740-81978762 TAATTAAAAGAGAAGAATGGAGG - Intergenic
1099524464 12:83702565-83702587 CACTATAAAGAAAAGTATGGAGG + Intergenic
1100017919 12:90034588-90034610 CAATGTGAAGAGGAGATTGGAGG + Intergenic
1100111725 12:91252682-91252704 CATTTTAAAAAAAAGATTGGAGG - Intergenic
1101320850 12:103671830-103671852 CATTTTAAAGAACAGAATGAGGG - Intronic
1101457549 12:104851803-104851825 CTTTCTAAAGAAAAGAATAGAGG + Intronic
1101553259 12:105783324-105783346 CTCTGTAAAGAGTAGAATGATGG - Intergenic
1103038225 12:117673471-117673493 GATGGAAAAGGGAAGAATGGTGG + Intronic
1103639789 12:122340716-122340738 AATGGAAAAGAAAAGAATGGAGG + Intronic
1103714090 12:122933260-122933282 CATTGTAAAGTGAATAATCCGGG + Intronic
1104097756 12:125574204-125574226 CACTTTACAGAGAAGAATGTAGG - Intronic
1105954362 13:25266369-25266391 GATTGTAAAGAGAAAAATGAAGG - Intronic
1105977491 13:25485312-25485334 CCATGTACAGAGAATAATGGTGG - Intronic
1106457121 13:29937258-29937280 CATTGTATAGAGAAGTATTCTGG - Intergenic
1106525318 13:30535470-30535492 AATGGTAAAGAGAAGCATGGAGG - Intronic
1107135917 13:36944046-36944068 CAATGTGAAGACAAGAATGAAGG - Intergenic
1107443642 13:40450368-40450390 TATTGCAATGAGAAGAATGTGGG - Intergenic
1108900247 13:55394339-55394361 GATTGCCAAGAGTAGAATGGTGG + Intergenic
1108921485 13:55679999-55680021 GATTCTGAAGAGTAGAATGGTGG + Intergenic
1109660964 13:65459461-65459483 CATTATAATGAGAAAAACGGTGG - Intergenic
1110643703 13:77856032-77856054 CATTGAAAAGAAAAGAAATGAGG - Intergenic
1110932719 13:81242805-81242827 GAGTGTCAAGAGAAGAAGGGAGG - Intergenic
1110944048 13:81390664-81390686 AATTTTTAAGAGAGGAATGGGGG - Intergenic
1111835050 13:93377738-93377760 TATTTTAAATAGAAGATTGGTGG - Intronic
1112493570 13:99887767-99887789 CCTTGTCAAAAGTAGAATGGTGG + Intronic
1113072256 13:106433439-106433461 CACTGCAAAGAGAAGAGTGATGG - Intergenic
1113237133 13:108290164-108290186 CATTGTTAAGTAAAGAATGCAGG - Intronic
1114848841 14:26358278-26358300 AAATGTATAGAGTAGAATGGTGG + Intergenic
1115293775 14:31802574-31802596 CATTGTGTAGAAAAGAAGGGCGG - Intronic
1116226411 14:42159135-42159157 CATTGTAAAAAGAATGAAGGGGG + Intergenic
1116475283 14:45331933-45331955 CGGTGTAAAGAAAAGAATGAGGG - Intergenic
1117362102 14:54985837-54985859 AAATGGAAAGAGAAGAATCGAGG + Intronic
1117365753 14:55025868-55025890 CAGTATAAAGAGATGAGTGGTGG - Intronic
1117447248 14:55816056-55816078 CATTGTAAAGAAATGAATACAGG - Intergenic
1117487574 14:56213589-56213611 CATTGTAAAGAGAAGAATGGTGG + Intronic
1118145185 14:63127001-63127023 CATTATAAAGATAGAAATGGTGG - Intergenic
1118203451 14:63699377-63699399 GTTTGTAAAGGGAAGAAGGGAGG + Intronic
1118508018 14:66436779-66436801 TATTTTAAAGAAAAGAATAGAGG - Intergenic
1118868986 14:69726117-69726139 CATAGCAAGGAGAAGAAAGGCGG + Intergenic
1119586759 14:75842960-75842982 CATAGCAAAAAGAAGAAAGGTGG + Intronic
1120428882 14:84388439-84388461 CAAAGAAAAGAGTAGAATGGCGG + Intergenic
1121178246 14:91906974-91906996 CATGCTGGAGAGAAGAATGGGGG + Intronic
1121553673 14:94820550-94820572 CACTGAAGAGAGAAGAATGAAGG + Intergenic
1122337165 14:101000682-101000704 CATGGTGAATAAAAGAATGGAGG + Intergenic
1122394941 14:101418699-101418721 CAGTGTAAATGGTAGAATGGAGG + Intergenic
1127044492 15:55011517-55011539 CTTTGTAAAGATTAGAATGTGGG - Intergenic
1127133440 15:55893303-55893325 AATTCTAAAGACAAGAATTGGGG + Intronic
1127374494 15:58370542-58370564 CAGTGAAAAGAAAGGAATGGGGG + Intronic
1127748011 15:62000973-62000995 CTATGTAATGATAAGAATGGGGG - Intronic
1129778357 15:78252019-78252041 CATAGCAGAGAGTAGAATGGTGG - Intergenic
1130082903 15:80750190-80750212 CTTTGTAAATAGAAGAATAAAGG + Intronic
1130151747 15:81316515-81316537 CATTTTTAAAATAAGAATGGTGG - Intronic
1130237474 15:82149744-82149766 CATGGAAGAGAGATGAATGGTGG + Intronic
1130834703 15:87638539-87638561 CATTGTAATGAGCAGAACGCTGG - Intergenic
1132084842 15:98899714-98899736 CTTGTTAAAGAGAAGAAAGGAGG + Intronic
1135031461 16:19042165-19042187 AAATGGAAAGAAAAGAATGGGGG - Intronic
1135869104 16:26132669-26132691 CAGTGCAAAGAGAAGCATTGAGG + Intronic
1137632405 16:49956230-49956252 CCTTGTACAAAGGAGAATGGAGG - Intergenic
1138224051 16:55277472-55277494 CATTCTAAGAAGTAGAATGGTGG - Intergenic
1139743304 16:69054133-69054155 GAGTGGAAAGAGAAGGATGGAGG + Intronic
1142975338 17:3640292-3640314 CTTTGTAAAGAGGGAAATGGTGG + Intronic
1143245247 17:5479249-5479271 CATTGAAAAGTTAACAATGGTGG + Intronic
1145857398 17:28174452-28174474 GATTTTGAAGAGAAGACTGGTGG + Intronic
1146684863 17:34834892-34834914 CATTGAAAAAAGGGGAATGGGGG - Intergenic
1146968059 17:37049651-37049673 CATTTTTAAGAGGAAAATGGAGG + Intronic
1146994873 17:37310926-37310948 GATTGGTAAGAGTAGAATGGAGG + Intronic
1149098383 17:52872252-52872274 CAATCGAAAGAGAAGAAGGGAGG - Intronic
1149369642 17:55980116-55980138 CATTATGAAAAGCAGAATGGAGG - Intergenic
1150171348 17:62998957-62998979 AATTGTAAACAGAAGAAAGCAGG + Intergenic
1150642692 17:66960299-66960321 CAAAGTAAAGTGAAGAATTGAGG + Intergenic
1151450275 17:74194461-74194483 CTTTGGAAAAAGAGGAATGGAGG - Intergenic
1203193747 17_KI270729v1_random:212807-212829 AATGGAATAGAGAAGAATGGAGG + Intergenic
1203203111 17_KI270730v1_random:12237-12259 AATGGAATAGAGAAGAATGGAGG + Intergenic
1153207532 18:2719292-2719314 CATTGAAAAGAAAAGAAAAGAGG - Intronic
1153938701 18:9956905-9956927 TCTTGTAAATATAAGAATGGGGG - Intronic
1155446762 18:25921168-25921190 GATTTGAAAGAGAAGAATGAAGG - Intergenic
1155522701 18:26685184-26685206 CAAGGGAGAGAGAAGAATGGTGG + Intergenic
1156123175 18:33870300-33870322 CATAGTAGAGAGTGGAATGGTGG + Intronic
1157507301 18:48237318-48237340 CATTGTGAGGAGAAGAATGGAGG + Intronic
1157874458 18:51259588-51259610 CAATGTGAAGAGTAGAGTGGAGG - Intergenic
1159446799 18:68550899-68550921 CATAGTAAATGAAAGAATGGAGG + Intergenic
1159573790 18:70150792-70150814 GATTGTAAACAGAAGAAAGATGG - Intronic
1159667310 18:71177311-71177333 CATAGTAGAGAGTAGAATAGTGG - Intergenic
1159885676 18:73902361-73902383 CAATGTAAATAGAAAAATGATGG - Intergenic
1161706692 19:5825455-5825477 CATTGTAAGGACAAGAAAAGAGG - Intronic
1161855925 19:6765433-6765455 CATTCTAAAGCAAAGAATAGGGG - Intronic
1163460935 19:17437096-17437118 CATTTTACAGAGAAGAAAGCTGG + Intronic
1164793027 19:31003996-31004018 CACTGTAGGGAGAAGAAAGGTGG + Intergenic
1165831572 19:38733261-38733283 CATTTTAGAGAGGAAAATGGAGG + Intronic
1167239637 19:48335912-48335934 AATTGTAAAGAGAAGAGGAGAGG + Intronic
925271503 2:2612700-2612722 CATAGAAGAGAGTAGAATGGTGG + Intergenic
926364462 2:12120501-12120523 CATTTGAAAGAGAAGCTTGGGGG - Intergenic
927622858 2:24680530-24680552 CATAGGAGAGAGTAGAATGGTGG + Intronic
927650401 2:24909552-24909574 CATTGTACAGAGAGAAATGGTGG - Intronic
928015725 2:27655185-27655207 AATTAGAAAGAGAAGAATGCTGG + Intronic
928947028 2:36780839-36780861 CATGGAAAAGAGAGGAAAGGAGG + Intronic
930044003 2:47152972-47152994 CTTTTGAAAGAGAAGGATGGTGG - Exonic
930144279 2:47985403-47985425 CATTTTAAAGAGAAGATTTCGGG + Intergenic
930389673 2:50745417-50745439 CAATGGAAAGAGAAAAAGGGAGG - Intronic
930590572 2:53321973-53321995 CAGAGTAAAGAGAAGAAGTGTGG - Intergenic
930678907 2:54234421-54234443 AATTGTAAAGAGATGAATCATGG - Intronic
931000287 2:57772690-57772712 CAATGGAAAGAGAAGAAAAGTGG + Intergenic
932297163 2:70635589-70635611 CATAGAAGAGAGTAGAATGGTGG + Intronic
932375998 2:71236284-71236306 CTAAGAAAAGAGAAGAATGGCGG + Intergenic
933832893 2:86224890-86224912 CAGTGTCAGGGGAAGAATGGAGG + Intronic
934289559 2:91679962-91679984 AATTATAAAGAGTAAAATGGTGG + Intergenic
934621091 2:95807544-95807566 CATTAAAAACAGAAGAATGGAGG + Intergenic
934812353 2:97291277-97291299 CATTAAAAACAGAAGAATGGAGG - Intergenic
934825341 2:97416646-97416668 CATTAAAAACAGAGGAATGGAGG + Intergenic
935358201 2:102224528-102224550 GAAGGTAGAGAGAAGAATGGTGG + Intronic
937829837 2:126407496-126407518 CATTCTAAAGATAGAAATGGTGG + Intergenic
938304262 2:130240416-130240438 CAATGTACAGAAAAGACTGGAGG - Intergenic
938452422 2:131433875-131433897 CAATGTACAGAAAAGACTGGAGG + Intergenic
939139385 2:138335493-138335515 CTTTCTAACCAGAAGAATGGAGG + Intergenic
939801626 2:146718431-146718453 GATTATAAAGAGAATAGTGGTGG + Intergenic
939809682 2:146815320-146815342 CATAGTAGAGAATAGAATGGTGG - Intergenic
940866308 2:158820813-158820835 CTTTATAAGGAGAAGAAGGGAGG + Intronic
941595838 2:167475979-167476001 CTTTGTAAAAAGAAGAAATGTGG - Intergenic
941624544 2:167816832-167816854 CACTTTAAAGAGCAGAATGAGGG + Intergenic
941658490 2:168170174-168170196 CATTGTTTTGAAAAGAATGGAGG - Intronic
941684003 2:168429062-168429084 CATTATGAAGTCAAGAATGGAGG - Intergenic
941763711 2:169273037-169273059 CCGTGTAAAGATAACAATGGGGG - Exonic
942082610 2:172415582-172415604 CATTTTAAAGAGAACACAGGTGG + Intergenic
943048681 2:182889661-182889683 CATGGTAGAGAGCACAATGGTGG - Intergenic
945054354 2:205855282-205855304 CATTGGAAATAGAGGAATGTAGG - Intergenic
945292276 2:208138037-208138059 CATTGATAAGAGATGCATGGGGG - Intergenic
945863250 2:215147994-215148016 CATTTTAAAGAGAATCATAGTGG + Intergenic
946558243 2:220883691-220883713 AAGGATAAAGAGAAGAATGGAGG + Intergenic
946559146 2:220892810-220892832 CATGGCAAAGTGAAGAATTGGGG - Intergenic
946716606 2:222559821-222559843 CACTGTGAAGAGATGAAAGGTGG + Exonic
946857969 2:223972052-223972074 AAAGGTAAAGTGAAGAATGGCGG - Intergenic
947269399 2:228317203-228317225 CACAGTAAAAAGAGGAATGGAGG - Intergenic
947672670 2:231948681-231948703 AGTTGTAGAGAGCAGAATGGTGG - Intergenic
1169521000 20:6372820-6372842 CATTTAATAGAGAAGACTGGGGG + Intergenic
1169795329 20:9456375-9456397 GATGGTAAAAAGATGAATGGGGG + Intronic
1170077405 20:12434549-12434571 CATTGTAATGGGGTGAATGGTGG + Intergenic
1171287279 20:23951574-23951596 CATTGTAAAGAGTACAAGGGTGG - Intergenic
1171565115 20:26176017-26176039 TATAGTAAAAAGAAAAATGGTGG + Intergenic
1171724920 20:28607702-28607724 GATAGCAAAAAGAAGAATGGAGG + Intergenic
1171753153 20:29075349-29075371 GATAGCAAAAAGAAGAATGGAGG - Intergenic
1171858420 20:30372291-30372313 GATAGCAAAAAGAAGAATGGAGG - Intergenic
1174022121 20:47538842-47538864 CATCTGAAAGAGAAGAATAGTGG - Intronic
1174755236 20:53152149-53152171 TATTGTACAATGAAGAATGGAGG - Intronic
1176754283 21:10714267-10714289 AATGGAAAAGAGTAGAATGGAGG - Intergenic
1177265561 21:18778850-18778872 CAATGTATAGAACAGAATGGTGG - Intergenic
1177995716 21:28094715-28094737 CATTCTAAAGAGGAGAATTATGG - Intergenic
1178387782 21:32168587-32168609 CATTGTAAAGGGTAGAAAAGAGG + Intergenic
1178735382 21:35144560-35144582 CATTGTTAATATAAGAGTGGGGG - Intronic
1178981914 21:37271482-37271504 AATCTTAAAGAGAGGAATGGGGG + Intergenic
1179019487 21:37625483-37625505 CCCTGCAGAGAGAAGAATGGAGG + Exonic
1179085884 21:38217302-38217324 GATTGTGAGGAGAAGAGTGGGGG + Intronic
1179497518 21:41782547-41782569 CATTTTAAAAATAAAAATGGTGG - Intergenic
1180298470 22:10966394-10966416 GATAGCAAAAAGAAGAATGGAGG + Intergenic
1180409942 22:12597412-12597434 GATAGCAAAAAGAAGAATGGAGG - Intergenic
1181184143 22:21089791-21089813 CATTGCAAAGTGAACAATTGAGG + Intergenic
1182000502 22:26915873-26915895 AATTACAAAGAAAAGAATGGGGG - Intergenic
1182517475 22:30867221-30867243 CATGGGAAAGACAAGACTGGTGG - Intronic
1183759974 22:39807178-39807200 CATTGTAAAGAAAGGACTGGAGG - Intronic
1184542461 22:45136186-45136208 CATTTAAAAGAGAAAAATGTAGG + Intergenic
1184958200 22:47906944-47906966 AATAGAAAATAGAAGAATGGGGG + Intergenic
1185079035 22:48699272-48699294 CATTGTAATCAGAACAATGAAGG - Intronic
949200130 3:1367333-1367355 CATAGTAAAGAGTAGCATGGTGG - Intronic
949326052 3:2865676-2865698 CACTTTAAAGAGAGGAATCGTGG + Intronic
950383593 3:12638037-12638059 CTGAGTAAAGAGAAGAATGATGG - Intronic
950941696 3:16899044-16899066 GGTGGTAGAGAGAAGAATGGAGG + Intronic
951285436 3:20806782-20806804 CATTGTAAAGCGCACCATGGGGG + Intergenic
951703083 3:25515721-25515743 TATGATAATGAGAAGAATGGTGG + Intronic
952344861 3:32473902-32473924 CATGGTAAAGGGAGGGATGGAGG - Intronic
953014177 3:39056933-39056955 GATTGTAATGAGAAGAAGGAGGG + Intronic
953219179 3:40952527-40952549 CATTGTGAAGAAGAGTATGGAGG - Intergenic
953479558 3:43238687-43238709 CATTTGAAAGATAAAAATGGAGG + Intergenic
953783644 3:45894283-45894305 CAGGGTAAAGAGGAGAAAGGTGG + Intronic
955312501 3:57903332-57903354 CATTCTAAAGAGAAGAGTGATGG + Intronic
955501485 3:59588641-59588663 CATTGTAGAGAACAGAGTGGAGG + Intergenic
955534450 3:59908267-59908289 CTTTGCAAAGAGAATAATGAAGG + Intronic
956647925 3:71475139-71475161 CATTGGAAATAGAAGCAGGGGGG - Intronic
957336441 3:78835505-78835527 CATTGTAATGTGAAGAATATAGG - Intronic
957587486 3:82150666-82150688 CATTGTAAAGAGAATACAGTAGG - Intergenic
957824840 3:85427369-85427391 AATTACAAAGAGGAGAATGGTGG - Intronic
958575434 3:95944270-95944292 CATAGTAGAGAGTAGAATAGTGG - Intergenic
960385540 3:117018050-117018072 CATTGCAAAGAGAGAAGTGGAGG - Intronic
962370985 3:134820473-134820495 CTTTATGAAGAGAAGAATCGGGG + Intronic
965408161 3:168296372-168296394 CATAGTAGAGAGGAGAATGATGG - Intergenic
967242884 3:187458335-187458357 CATTCCAGAGAGAAGAAAGGAGG + Intergenic
967979207 3:195055412-195055434 CATTGTATAGAGTAGGCTGGAGG - Intergenic
968177279 3:196561943-196561965 CATTTTATAGAGAAGAAAAGTGG - Intronic
968882058 4:3306149-3306171 CTCTGTAAAGAGACGAAGGGTGG - Intronic
969361969 4:6670226-6670248 CATTGGTAAGGGAAGAATGAAGG + Intergenic
970019324 4:11549242-11549264 GAATGTATAGACAAGAATGGTGG + Intergenic
970133638 4:12897937-12897959 AATTGTAAATAGAATAATTGAGG - Intergenic
970172109 4:13300537-13300559 GGATGTAAAGAAAAGAATGGAGG + Intergenic
970351456 4:15205861-15205883 CATTGAAAGGAGAAGTTTGGGGG - Intergenic
973028582 4:45306096-45306118 TATTGTAAGGAGAAGATTGAAGG + Intergenic
974292752 4:59954749-59954771 CATTATGAAGAGCAGAATGGAGG + Intergenic
975247394 4:72135443-72135465 CCTTGAAAATAGAAGAATGAGGG - Intronic
976043225 4:80912926-80912948 CACTCTAAAGAGAAGAAAGAGGG + Intronic
976897000 4:90125396-90125418 CATTGTAAAAAGAAGGAGGGAGG + Intergenic
977704236 4:100053326-100053348 CATTGTACAGAGAAGAAAACTGG - Intergenic
977760667 4:100732858-100732880 CATGGTAGGGAGAAGCATGGAGG + Intronic
977814288 4:101396472-101396494 CATTGTAAAGAGAGAAATTCAGG - Intergenic
977862371 4:101978687-101978709 CATTGAAAAAAAAAGAATTGTGG + Intronic
977967948 4:103177417-103177439 AAGAGTCAAGAGAAGAATGGTGG - Intronic
978249690 4:106615564-106615586 CTTTGTAAACAGAAGAAAAGAGG + Intergenic
979343428 4:119556343-119556365 CATTTTAAACAGTAGGATGGGGG - Intronic
979377881 4:119969394-119969416 GATTATAAAGAGTAGATTGGTGG - Intergenic
979823865 4:125208306-125208328 CATTATAAAGAGCATATTGGAGG - Intergenic
979930313 4:126621760-126621782 CAATGTAAAGAGAAAACTGCAGG + Intergenic
980178769 4:129378819-129378841 CATTATAAAAAGAAGAAATGAGG - Intergenic
980650808 4:135712287-135712309 CATTATAATGAGAAAAATGCCGG - Intergenic
980872881 4:138630234-138630256 AATTGTCAAGAGGACAATGGAGG - Intergenic
981148992 4:141359495-141359517 CAAGGAAAAGATAAGAATGGAGG - Intergenic
981306098 4:143248318-143248340 GATTGTAAAGAGAAGAACTCTGG - Intergenic
981863579 4:149386252-149386274 CAGTGGAGAGAGAAGAATGAGGG + Intergenic
982022581 4:151218281-151218303 CTTTTTAAAGAGAAAAATTGAGG - Intronic
983211643 4:164964502-164964524 CTTTGAAAAGATAAAAATGGAGG + Intronic
984022220 4:174499488-174499510 CATTGAAAAGAGAAACAAGGTGG - Intronic
984141700 4:176012115-176012137 CTTTGTGCAGTGAAGAATGGAGG - Intergenic
984365254 4:178791454-178791476 CATTGTTAAGGGAATAAGGGAGG + Intergenic
984391235 4:179136836-179136858 CATTATAAAGAAAAGAGCGGTGG + Intergenic
984838905 4:184050271-184050293 CATTGTAAAGATAAGGAAAGTGG + Intergenic
986058206 5:4160684-4160706 CATGGTATAAAGAAGAATGATGG - Intergenic
986422873 5:7601696-7601718 CAGAGTGAAGAGAAGAATGAAGG - Intronic
987445380 5:18011264-18011286 TATAGTGAAGAGAAGAAGGGTGG - Intergenic
987820322 5:22957275-22957297 CATTGTAAATAAAATAATGCAGG + Intergenic
988844214 5:35112990-35113012 CATTGTAAAGAGCTGGATCGTGG - Intronic
989994002 5:50805287-50805309 CATAGTTAACAGAAGAAAGGAGG + Intronic
990180689 5:53157103-53157125 CATTGTCAACAGAACAATAGTGG + Intergenic
991596895 5:68315538-68315560 CATTTTTAAGGGAAGATTGGAGG + Intergenic
992001575 5:72441502-72441524 GATTGTGAAGAGAAGACTGTGGG - Intergenic
992382698 5:76254445-76254467 CATTGTAAAGCTAAACATGGAGG - Intronic
993034492 5:82741984-82742006 CATTAAAAAGATAATAATGGTGG - Intergenic
993382599 5:87224841-87224863 CTTTGAAAATGGAAGAATGGAGG + Intergenic
994113490 5:96035603-96035625 GAGTGTAAAGAGTGGAATGGGGG + Intergenic
995323797 5:110867982-110868004 CATTTTAAAGATGAGAATGCTGG - Intergenic
995354150 5:111218717-111218739 CACTGTGAAGAACAGAATGGAGG - Intergenic
995419242 5:111944601-111944623 AATTGGAAAGAGAAGAAGGCTGG - Intronic
996369834 5:122741475-122741497 TAAGGTAAAGAGAAGAATGAAGG - Intergenic
996768412 5:127059425-127059447 CATGGTAAAGAAAACAATGAGGG + Intronic
996845035 5:127889700-127889722 CAATTTAAAGAGTAGAATAGAGG - Intergenic
997173079 5:131744578-131744600 CAGTGTTAAGAGAAGAAATGAGG - Exonic
999233435 5:150076555-150076577 CATTGTAAAGAGGAGAGTGATGG - Intronic
999646266 5:153719746-153719768 CATTGTAAGGTGTGGAATGGAGG + Intronic
999725824 5:154436980-154437002 CATTGGATAGAGAATAGTGGTGG + Intergenic
999784356 5:154878212-154878234 ACTTGTAAAGAAAAGAAAGGAGG - Intergenic
1001220278 5:169894744-169894766 CATGGTAAAGATAAGAACAGTGG - Intronic
1001739888 5:174044248-174044270 CTTTGGAAAGAAGAGAATGGAGG + Intergenic
1002361197 5:178672582-178672604 GATTGAAAAGAGAAGAATATGGG + Intergenic
1002363274 5:178690472-178690494 CATAGAAGAGAGTAGAATGGTGG - Intergenic
1003532223 6:6947162-6947184 CATTGTGAAGACAAGGATGAAGG + Intergenic
1003613975 6:7638322-7638344 CATGGAAACAAGAAGAATGGTGG + Intergenic
1003899595 6:10641733-10641755 CATTGAAAAGGGAAGAATGCAGG - Intergenic
1004915313 6:20326800-20326822 CATTATAAGGTGAAGCATGGTGG + Intergenic
1005060537 6:21773179-21773201 CATTGGAAAAAGCAGAAAGGAGG + Intergenic
1005164265 6:22901303-22901325 AGTTGTAAAGGCAAGAATGGTGG - Intergenic
1005197857 6:23310006-23310028 CATGGTAAAGAGAAGAACAATGG + Intergenic
1007019136 6:38501774-38501796 CATAATAAAGAGAAGACTGCTGG - Intronic
1007094371 6:39204360-39204382 CATTGTACAGAGAAGCAGGCAGG - Intronic
1007392767 6:41560098-41560120 CATTATACAGAGAAGAAAAGAGG + Intronic
1008690259 6:53971073-53971095 CAATGTAAAGAGAAGGGAGGGGG + Intronic
1009906541 6:69875921-69875943 CATTATAAAGAGAGGAAAGGAGG + Intronic
1009996622 6:70902406-70902428 CATTGTAGAGAACAGTATGGAGG + Intronic
1010059695 6:71608279-71608301 CATTGTACAGGGCTGAATGGTGG - Intergenic
1011172602 6:84522500-84522522 CAGAGTAAAGACAAGAAGGGAGG + Intergenic
1012086757 6:94836535-94836557 GATTGTAATGAGGAGAAAGGAGG - Intergenic
1012931957 6:105326785-105326807 CAGAGAAAAGAGAAAAATGGAGG + Intronic
1014184027 6:118414974-118414996 CATGGGAGAGAGTAGAATGGTGG + Intergenic
1014820068 6:125979163-125979185 CATTGTAAAGTAAATAATAGTGG - Exonic
1014987239 6:128026490-128026512 CATTGTAAAGATGAGAAAAGTGG - Intronic
1017115351 6:150971061-150971083 CAAAGTAAAGAGTAGAATAGTGG + Intronic
1018816458 6:167336216-167336238 CACTGTAGAGAGCAGCATGGAGG - Intronic
1019024641 6:168948808-168948830 CATTCAAAAGAGAAGTATGGAGG - Intergenic
1019862603 7:3674304-3674326 CATGGTAATGAGAAGGAAGGAGG + Intronic
1020679101 7:11214856-11214878 CATTCTGAAGAGAAGGGTGGTGG - Intergenic
1020827363 7:13046668-13046690 CATTGTACAGTGAACAATAGTGG + Intergenic
1021018555 7:15566914-15566936 CACTGTCATGAGAACAATGGGGG + Intergenic
1021094733 7:16523058-16523080 GATGGTAAAGAGAAAAATGAAGG + Intronic
1021230131 7:18076318-18076340 CATAGCAAAGAGTAGAATGGTGG - Intergenic
1021241952 7:18213291-18213313 GGTTGTAAGGAGAAAAATGGAGG - Intronic
1023226744 7:37977894-37977916 CAATGTACAGAAAAGACTGGAGG + Intronic
1023812793 7:43925441-43925463 CATAGTAAAGGTAAGAATTGTGG - Intronic
1024139823 7:46450820-46450842 CATGGTCAACAGAAGAATTGAGG + Intergenic
1024560458 7:50640487-50640509 CCTTCTAAAGAGAAGGGTGGAGG - Intronic
1024561163 7:50646679-50646701 CTTTGGAAAGAGATGAGTGGGGG + Intronic
1024783612 7:52880597-52880619 CATTGGGAGGAGAATAATGGTGG - Intergenic
1025868879 7:65411817-65411839 CATTGAAATGAGGTGAATGGAGG + Intergenic
1026457305 7:70583807-70583829 CATTTTTAAAAGAAGAATGCTGG - Intronic
1027528131 7:79296687-79296709 CATAGTAGAGAGTAGAATGGTGG + Intronic
1027682162 7:81234257-81234279 TATTCTAAAGTGAAGAATGAGGG + Intergenic
1028109709 7:86925190-86925212 CATTTTAAAGAGTAGCATGATGG - Intronic
1028596973 7:92556018-92556040 CATTGTAAGGACAGGCATGGTGG + Intergenic
1030078363 7:105756116-105756138 AATTGTAAGGAAAAGAATGAGGG - Intronic
1031023829 7:116658683-116658705 CAATGTAAAAAAAAGAAGGGGGG + Intergenic
1032619610 7:133514798-133514820 CATTGTAATGAGAAAAATCTGGG + Intronic
1032750630 7:134836862-134836884 AATTGTTAATAGAAGAATGAGGG - Intronic
1033471860 7:141657327-141657349 GACTGTCAAGTGAAGAATGGTGG - Exonic
1037480226 8:19298241-19298263 CATTGTGATGAGAGGAAAGGAGG + Intergenic
1037604099 8:20422935-20422957 CAAGGTAAAGAGAGGAATGGAGG - Intergenic
1038144799 8:24885520-24885542 CATAGAAAATGGAAGAATGGGGG - Intergenic
1038287923 8:26222605-26222627 CTTTAAAAAGAGAAGAATTGAGG - Intergenic
1038352470 8:26790025-26790047 CATTGTAAAGAACATTATGGTGG + Intronic
1038902972 8:31864792-31864814 CAGTGTAGAGAGCAGATTGGTGG + Intronic
1039179379 8:34848072-34848094 CATTATAAATAGAATAATAGTGG - Intergenic
1039651376 8:39342602-39342624 CAAAGTAGAGAGTAGAATGGTGG + Intergenic
1039867910 8:41521764-41521786 AATTGTAAAAAGAAGGAAGGAGG + Intergenic
1040745895 8:50642122-50642144 CTTTGCAATCAGAAGAATGGAGG - Intronic
1042346932 8:67737036-67737058 CATTGAAAAGGGAAGATTGGAGG - Intronic
1043386634 8:79755424-79755446 AATTTTGAAGAGAAGCATGGTGG - Intergenic
1043610303 8:82054682-82054704 GATGGTAAAGAGATTAATGGTGG - Intergenic
1043822795 8:84889336-84889358 CATTGTAAATGGCAGCATGGAGG - Intronic
1043884130 8:85579143-85579165 AGTTGTAGAGAGCAGAATGGTGG - Intergenic
1044168050 8:89013728-89013750 TATTGGAAAGAGGAGAAAGGAGG + Intergenic
1044459986 8:92432911-92432933 CATTTTAAACAGAAAAGTGGAGG - Intergenic
1046781336 8:118218555-118218577 CATAGCAGAGAGTAGAATGGTGG - Intronic
1047074169 8:121381046-121381068 TATTGGAGAGAGAAAAATGGAGG - Intergenic
1047622020 8:126617698-126617720 CATAGGAAAGAGAAGACTTGTGG + Intergenic
1048369092 8:133761353-133761375 CAATGAAGAGAGATGAATGGTGG + Intergenic
1048781988 8:138012213-138012235 CTTTGTAGAGAAAAGAATGGGGG - Intergenic
1050060122 9:1699692-1699714 CAATGTAAAGAGAAGAAGAAAGG - Intergenic
1051325576 9:15963988-15964010 CATTCTAGCGAGAAGAAAGGAGG - Intronic
1051740230 9:20244335-20244357 CATTGTAAAGAGCAGGAAGGAGG + Intergenic
1052048008 9:23817353-23817375 CTTTATGAAGAGAAGGATGGGGG - Intronic
1053724681 9:40987479-40987501 GATAGCAAAAAGAAGAATGGAGG - Intergenic
1054341289 9:63864520-63864542 GATAGCAAAAAGAAGAATGGAGG + Intergenic
1054976225 9:71149067-71149089 AATTGTAAAGAGAAGGATGGCGG + Intronic
1055511072 9:76996096-76996118 TATTATAAAGAGAAGCATTGGGG + Intergenic
1055613190 9:78044091-78044113 AACTGTAAAGAGTAGGATGGAGG + Intergenic
1056564692 9:87760615-87760637 CATTGTGGAGAGCAGTATGGAGG - Intergenic
1057835392 9:98440512-98440534 CATTGTAAATTGTAGAAGGGGGG - Intronic
1057871560 9:98722058-98722080 CAGTGTCAAGTGAAGACTGGGGG - Intergenic
1059011443 9:110466191-110466213 CTTAGTATAGAGAAGCATGGTGG - Intronic
1059424017 9:114209653-114209675 CCTAGGAAAGAGAAGAAAGGGGG - Exonic
1059585690 9:115603684-115603706 TATTCTAAAGAGAAGCATAGTGG - Intergenic
1060474236 9:123974886-123974908 CATTTTACAGAGAAGAAAAGCGG - Intergenic
1186242138 X:7580463-7580485 AATGATAAAGAGAAGAGTGGAGG + Intergenic
1186718715 X:12279954-12279976 TTTTGTAAAGAGAAGAACTGAGG - Intronic
1186903846 X:14089478-14089500 AATTTAAAAGAGAAAAATGGTGG - Intergenic
1186989356 X:15050546-15050568 CATAGTAAAGGGCAAAATGGTGG + Intergenic
1187930920 X:24292889-24292911 CATTTTAGTAAGAAGAATGGGGG - Intergenic
1188049503 X:25467203-25467225 AAAAGTAAAGAGTAGAATGGTGG - Intergenic
1188087456 X:25918120-25918142 CACTCAAAAGGGAAGAATGGAGG - Intergenic
1188134010 X:26471713-26471735 CATTGTTAAGAGAAGAAGCTGGG - Intergenic
1188165229 X:26854396-26854418 CATTGTAAAAAGTAGAATGTTGG - Intergenic
1188220047 X:27530360-27530382 TATAGAAAACAGAAGAATGGCGG - Intergenic
1189407433 X:40737330-40737352 AAAAGTAAAGAGTAGAATGGTGG - Intergenic
1189561752 X:42198196-42198218 AAAAGTAAAGAGTAGAATGGTGG - Intergenic
1189648708 X:43164556-43164578 CTTTGTAAAGAGAAAAATGAAGG + Intergenic
1192244967 X:69364478-69364500 CTTTGTTAAGGGAAGGATGGAGG - Intergenic
1192346999 X:70318296-70318318 CATTTTAAATGGAAGAATGAAGG - Intronic
1192923242 X:75729722-75729744 CATTTTCAAGGGAAGAATTGAGG - Intergenic
1193469115 X:81877626-81877648 AAATATAAAGAGTAGAATGGTGG + Intergenic
1193761520 X:85472731-85472753 CACTGTAAAGAAGAGTATGGAGG + Intergenic
1193847790 X:86496560-86496582 CAATGTAAAGAGAAGGGAGGGGG + Intronic
1196089982 X:111729989-111730011 CATTTTACAGTGAAGAATTGAGG + Intronic
1197072783 X:122320867-122320889 CATAGAAATGAGTAGAATGGTGG + Intergenic
1197468061 X:126831155-126831177 CATTGTAAAATGAAGCATGTAGG + Intergenic
1198967316 X:142241085-142241107 GATTGTAAACCGCAGAATGGAGG + Intergenic
1199195580 X:145026209-145026231 CAATGTAGAGTAAAGAATGGAGG - Intergenic
1200051848 X:153436987-153437009 CATTATAAAAAGAAGAAATGTGG + Intergenic
1200300105 X:154965579-154965601 TATTGCAAAGAAAAGAAAGGAGG - Intronic
1202201881 Y:22360922-22360944 CATTGCAATGAAAAGAATAGTGG - Intronic