ID: 1117489413

View in Genome Browser
Species Human (GRCh38)
Location 14:56231138-56231160
Sequence CTTCCACACAGTAAAGTGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 166}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117489406_1117489413 24 Left 1117489406 14:56231091-56231113 CCCAGATTCATAAAGCAAGTCTT 0: 77
1: 6291
2: 3516
3: 2330
4: 2140
Right 1117489413 14:56231138-56231160 CTTCCACACAGTAAAGTGGGGGG 0: 1
1: 0
2: 1
3: 18
4: 166
1117489408_1117489413 -5 Left 1117489408 14:56231120-56231142 CCTACAAAGAGACTTAGACTTCC 0: 109
1: 6809
2: 3381
3: 1541
4: 942
Right 1117489413 14:56231138-56231160 CTTCCACACAGTAAAGTGGGGGG 0: 1
1: 0
2: 1
3: 18
4: 166
1117489407_1117489413 23 Left 1117489407 14:56231092-56231114 CCAGATTCATAAAGCAAGTCTTT 0: 59
1: 2983
2: 5941
3: 2801
4: 1693
Right 1117489413 14:56231138-56231160 CTTCCACACAGTAAAGTGGGGGG 0: 1
1: 0
2: 1
3: 18
4: 166

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117489413 Original CRISPR CTTCCACACAGTAAAGTGGG GGG Intronic
900461315 1:2803310-2803332 CTGCCACAGACAAAAGTGGGCGG + Intergenic
900714523 1:4135601-4135623 CTTACAAACATCAAAGTGGGTGG + Intergenic
901671487 1:10858605-10858627 CATCCATGCAGAAAAGTGGGGGG - Intergenic
903014658 1:20354076-20354098 CTCCCACTCAGTGAAGTAGGAGG - Exonic
904291186 1:29486851-29486873 CTTCCAGACAGTAAAGAAGGTGG - Intergenic
906208649 1:44000282-44000304 CTTCCAGGCAGTGAGGTGGGTGG - Intronic
908714059 1:67051617-67051639 CTTCCACACAGCAAAATTAGAGG - Intronic
909317686 1:74245130-74245152 CTTCCAAAAAGAAAGGTGGGGGG + Intronic
910761632 1:90738333-90738355 GTTCCTCACAGTACAGTGAGTGG + Intergenic
911329374 1:96509604-96509626 CTTCCAGAAAGTAAAGGAGGGGG + Intergenic
911474220 1:98356518-98356540 CTTCCAGATAGTAAAGTCAGGGG - Intergenic
911893085 1:103397260-103397282 TTTCCAAACAGTAAAGATGGTGG + Intergenic
914351870 1:146846922-146846944 CATGCACACAGTCAAGTGGGTGG + Intergenic
916007685 1:160677253-160677275 CTTCCACTGAGAAAAGTGAGGGG + Intergenic
917241629 1:172954970-172954992 CTTCCACTCCGTCAGGTGGGAGG - Intergenic
921130428 1:212215116-212215138 CATCCAGACAGCAAAGGGGGAGG - Intergenic
923017622 1:230139179-230139201 CTTTCAAACAGTAAGGTGAGGGG - Intronic
924380308 1:243457025-243457047 CTTCCAAAAAGGAAAATGGGCGG + Intronic
1063786863 10:9394510-9394532 TTTCCACACAGGAATTTGGGAGG + Intergenic
1064319352 10:14288224-14288246 CTTCCCAACAGTAAAGTAGTAGG + Intronic
1065166849 10:22988476-22988498 CTCCCATTCAGTAAAGTTGGTGG + Intronic
1067813080 10:49446258-49446280 CTCCCTCACAGTAAATTGGGGGG - Intergenic
1069018325 10:63457405-63457427 CTTCCAAACAGTAGAGACGGTGG + Intronic
1071532539 10:86400856-86400878 CTTCCAACCCGAAAAGTGGGTGG - Intergenic
1071866519 10:89740499-89740521 CTTCCACAGAGTTTGGTGGGTGG + Intronic
1073086301 10:100891613-100891635 CTTGCAGACAGTAAAATGGATGG + Intergenic
1076102651 10:127795291-127795313 CTCCTACTCTGTAAAGTGGGGGG + Intergenic
1078387845 11:10908618-10908640 CTGCCACACAGAAAAGGTGGGGG - Intergenic
1078503034 11:11902068-11902090 CTTCCAAACAATCAAGTTGGAGG - Intronic
1079774456 11:24506496-24506518 CGTGCACACAGAAAAGTGAGGGG + Intronic
1081127755 11:39341537-39341559 CCTACAAACAGTAAAGTGTGGGG + Intergenic
1081622217 11:44625294-44625316 TTTCCACACTGTAAAGGGGTGGG - Intergenic
1085104163 11:73827586-73827608 CCTGCAAACAGTACAGTGGGGGG + Intronic
1085476746 11:76793951-76793973 CTTCCAGACTGGAAGGTGGGTGG - Intronic
1086817784 11:91394595-91394617 TTCCCACAAAGTAAACTGGGGGG - Intergenic
1087329029 11:96755977-96755999 CTTCCAAACAGCAAAGATGGTGG + Intergenic
1091699687 12:2651465-2651487 TGTCCACTCATTAAAGTGGGCGG + Intronic
1094743241 12:33313806-33313828 CTTCTACATAGAAAGGTGGGGGG + Intergenic
1095799832 12:46260226-46260248 CTTCTACACAGAAAGTTGGGAGG - Intronic
1098148369 12:67520768-67520790 CTTCCCCACATTAAATTGGATGG + Intergenic
1101295289 12:103417211-103417233 CTTTGCCACAGTTAAGTGGGGGG - Intronic
1102554365 12:113717188-113717210 CTTCCTCACAGTATGGTGGCTGG - Intergenic
1102716330 12:114976202-114976224 CTTCCCATCTGTAAAGTGGGAGG - Intergenic
1106601551 13:31191829-31191851 CTACCACACAGAAAAGGGGGTGG - Intergenic
1107084626 13:36413320-36413342 CTTCAACACAGGAATTTGGGAGG - Intergenic
1107887329 13:44884662-44884684 CTTCCCCACAGCATAGTGGCTGG + Intergenic
1108567783 13:51718298-51718320 ATTCCAGGCAGTAAAGTGGAGGG - Intronic
1110452093 13:75648189-75648211 CTTTCAGACACCAAAGTGGGAGG - Intronic
1112256879 13:97842180-97842202 CTTGCCCACAGGAAGGTGGGAGG - Intergenic
1112911031 13:104483851-104483873 CTCCCACACAGTAAATTCGGAGG + Intergenic
1117489413 14:56231138-56231160 CTTCCACACAGTAAAGTGGGGGG + Intronic
1118492966 14:66279738-66279760 CTTCCTCACAGTATGGTGGCTGG - Intergenic
1120044970 14:79795418-79795440 CTCCCACAGAGAAATGTGGGAGG - Intronic
1120177448 14:81310038-81310060 TTTCCACACTTTAAAGTGAGGGG + Intronic
1128144178 15:65323226-65323248 CTTCCTCACAGCATAGTGGCTGG - Intergenic
1129898277 15:79124653-79124675 CTTCCTCACAGTATGGTGGCTGG - Intergenic
1132331444 15:101014844-101014866 CTTCGACACAGGAATGTGGGGGG + Intronic
1133385812 16:5369537-5369559 CTTCTTCACTGTAAAGTGGGAGG - Intergenic
1137353864 16:47739037-47739059 CTTTTACACAGAAAGGTGGGGGG + Intergenic
1138088191 16:54153102-54153124 CTTCCATATAGGAATGTGGGAGG - Intergenic
1139982163 16:70868614-70868636 CATGCACACAGTCAAGTGGGTGG - Exonic
1142540140 17:652504-652526 CTTCCTCACGGTAAGGTGGCTGG - Intronic
1143050058 17:4117964-4117986 CATCCTCACAGTAAGGTGAGGGG + Intronic
1143879557 17:10019607-10019629 CTACCACCCAGCACAGTGGGAGG + Intronic
1143891757 17:10107607-10107629 CTTACACACAGTCCAGTGGGGGG + Intronic
1143891792 17:10107774-10107796 CTTACACACAGTCCAGTGAGGGG + Intronic
1144193083 17:12864003-12864025 CTTCCTCACAGTATGGTGGTGGG + Intronic
1144471455 17:15545784-15545806 CTCCTTCACAGTAAAGTGGCTGG - Exonic
1146943937 17:36861619-36861641 CTTCCAGTCAGTAAAGGAGGTGG + Intergenic
1148974190 17:51512384-51512406 CTGCCGCACAGAAAAGGGGGTGG - Intergenic
1154169739 18:12042721-12042743 CTTTCACACAGAAAAGGGGAGGG - Intergenic
1157107877 18:44791920-44791942 CTTCCCCACAGTTGAGTAGGAGG - Intronic
1158266336 18:55664634-55664656 CTGCCTCACAGAAAAGGGGGAGG - Intronic
1160294108 18:77622244-77622266 CTGCCACACAGAAAAGGGGAGGG + Intergenic
1164818764 19:31227685-31227707 TTTTCACTCAGTAAAGTTGGAGG + Intergenic
1166284405 19:41815092-41815114 CTTCAAACCACTAAAGTGGGTGG + Intergenic
1167120799 19:47515267-47515289 CTTCCACAGGGTCACGTGGGAGG - Intergenic
927379704 2:22464735-22464757 CTGCCCCACAGTAAAGGGTGTGG - Intergenic
933424624 2:82094287-82094309 TTTCTGCACAGTAAAGTGGTAGG - Intergenic
935235461 2:101134753-101134775 CTTCAACACAGTAATTTAGGGGG + Intronic
936036996 2:109120898-109120920 TGTCTACACAGTAAAGAGGGTGG + Intergenic
936503852 2:113088815-113088837 TTTCCACACAGTGCAATGGGAGG + Intergenic
937951504 2:127391347-127391369 CTCCCACACAGTAAAGAAGGGGG + Intergenic
938711492 2:133979435-133979457 CTTCCACTCACTCGAGTGGGTGG + Intergenic
938991659 2:136635896-136635918 CTTTTACACAGAAATGTGGGAGG - Intergenic
939363467 2:141203567-141203589 CTCCCACACAATAATGGGGGGGG + Intronic
943805305 2:192117668-192117690 CTGCCATGCAGAAAAGTGGGGGG - Intronic
946733938 2:222735427-222735449 CTTACATACAGTAAAGTGAGGGG - Intergenic
947487897 2:230569327-230569349 CTTCTCCACAGAAATGTGGGTGG - Intergenic
947539420 2:230964693-230964715 CTCCCACACAGTGCAGCGGGAGG + Intergenic
947969278 2:234308556-234308578 CTTGCACACAGTATCGTTGGCGG - Intergenic
1170232187 20:14061904-14061926 CTTAAACACATTAAAGTTGGAGG - Intronic
1175446153 20:59021140-59021162 CTCACACACAGAGAAGTGGGAGG + Intronic
1179279403 21:39921588-39921610 CTTCCACATATTAATTTGGGTGG - Intronic
1179601306 21:42479268-42479290 CATCCCCACAGCACAGTGGGAGG + Intronic
1182459082 22:30471679-30471701 CTTCCAGGCAATAACGTGGGTGG - Intronic
1182557394 22:31136690-31136712 CTTCCACACAGTCCAGTGGAGGG + Exonic
1183085256 22:35483180-35483202 CTACCCCACAGGAGAGTGGGAGG - Intergenic
1183265988 22:36825809-36825831 CTTCGACACAGGAATCTGGGGGG - Intergenic
1184509581 22:44925823-44925845 CTTCCACAAAGCAAGGTGTGTGG + Intronic
1184602918 22:45554130-45554152 CTTCCAGCCAGTAGAGCGGGAGG + Intronic
951483948 3:23191480-23191502 CTTCCACCCAGCATAGTGGTTGG - Intergenic
952969461 3:38641687-38641709 CTTCCCCACAGTAAGGATGGGGG + Intronic
953384524 3:42499105-42499127 CATCCAGACAGCAACGTGGGTGG + Intronic
956604835 3:71064194-71064216 TTCACACACAGTAAAGGGGGAGG - Intronic
956749398 3:72334215-72334237 CTTCCTCACAGTATGGTGGCTGG - Intergenic
961318756 3:126058026-126058048 CTTCCTCACAGCAGAGTGGCTGG - Intronic
963304425 3:143635238-143635260 CTTCCTCACAGCAAGGTGGCTGG + Intronic
963778950 3:149467550-149467572 CTTCCATATAGCAAAGAGGGAGG + Intergenic
963805211 3:149715104-149715126 CTTCCACACAGACAAGTAGAGGG - Intronic
965246586 3:166279273-166279295 CTTGCACACAGTACATTGTGGGG + Intergenic
965410357 3:168322443-168322465 ATTCTACACAGTATAATGGGTGG + Intergenic
968228295 3:196989601-196989623 CTTCAACACAGGAATTTGGGAGG - Intronic
968883196 4:3311973-3311995 TTTCCACACAGTGAAGAGGCTGG + Intronic
970260334 4:14217648-14217670 ATTCCACACAGGAAAGGGTGAGG - Intergenic
970464164 4:16306417-16306439 CTTTGACACACTGAAGTGGGTGG - Intergenic
970818073 4:20181355-20181377 CTTCCAGCCACTAAAGTAGGAGG + Intergenic
972393609 4:38636584-38636606 CTTCCACACAGGATAGTGTGAGG - Intergenic
973295792 4:48519260-48519282 TTTCCAGAGAGTAAAATGGGAGG - Intronic
975290110 4:72667852-72667874 CTTCTACAGAAGAAAGTGGGGGG - Intergenic
975825845 4:78318849-78318871 CTTACACCCAGTACAGTGAGAGG - Exonic
976814685 4:89133911-89133933 CTGCCACACAGAAAAGGTGGCGG + Intergenic
977077138 4:92468980-92469002 CTTCCACTCAGAAATGTGTGTGG - Intronic
977509310 4:97941210-97941232 CTTCCACAGAGTAAAGTCGCTGG - Intronic
977656459 4:99527072-99527094 ATTCAACACAGTAAAATTGGGGG - Intronic
978033820 4:103971012-103971034 CTGCAACACAGAAAAGGGGGAGG - Intergenic
986065022 5:4226932-4226954 CTTCCACCCAGTGGAGTAGGTGG + Intergenic
986284796 5:6351240-6351262 ATTCCTCTCAGTAAAGTGGCAGG + Intergenic
986797512 5:11226348-11226370 ATACAACACAGTAAAGCGGGTGG - Intronic
990314835 5:54574261-54574283 CTTCCTCACAGCATAGTGGCTGG + Intergenic
994863411 5:105230153-105230175 CTTCCAGACAATAAAGTAAGTGG + Intergenic
996296798 5:121928533-121928555 CTTCAACACAGTAAAGGGACTGG + Intergenic
996926880 5:128837924-128837946 CTCCCACAATTTAAAGTGGGGGG - Intronic
999355353 5:150924329-150924351 CTTCCAAAAATTAAAGTGGAAGG - Intergenic
999612771 5:153388191-153388213 TTTCCACACAGTAAACCAGGTGG + Intergenic
1000253223 5:159514570-159514592 CTTGCACAAGGAAAAGTGGGAGG + Intergenic
1000992424 5:167924635-167924657 CTTTGTCAAAGTAAAGTGGGAGG + Intronic
1001136774 5:169109006-169109028 CTTACCCACACTCAAGTGGGGGG - Intronic
1003010842 6:2426040-2426062 CCTCCACACATTACAGTGAGAGG - Intergenic
1003235288 6:4289762-4289784 CTTCAACACAGAAATTTGGGGGG + Intergenic
1005322535 6:24668885-24668907 CTGCCACACAGAAAAGGTGGGGG + Intronic
1007004258 6:38345666-38345688 CTTCCCAGCAGTCAAGTGGGGGG - Intronic
1009907471 6:69887849-69887871 GTTCCACACAGGAAAGAGGATGG + Intronic
1012324432 6:97897910-97897932 ATTCCTCACAGTAAAGTTAGAGG - Intergenic
1013000914 6:106021358-106021380 CTTGCACACAGTGAAGTGAGTGG + Intergenic
1015503599 6:133958887-133958909 CTTCCACACACTAAGGAGGTTGG + Intronic
1015518412 6:134107791-134107813 CTGCCACACAGAAAAGATGGGGG - Intergenic
1017147915 6:151251354-151251376 CATCCGCACAGTAAAGTGGTGGG + Intronic
1018758067 6:166866744-166866766 CCTCCACACAGGAATCTGGGAGG - Intronic
1019747586 7:2709327-2709349 CATCCTCACAGTGAAGTGGATGG + Intronic
1021276492 7:18657996-18658018 CTTCCACACAAAATAGTGGCTGG - Intronic
1022118780 7:27286650-27286672 TTTCCAGACAGTATGGTGGGAGG - Intergenic
1023040294 7:36167219-36167241 CTTCAACACAGGAATTTGGGGGG + Intronic
1024445335 7:49471116-49471138 TCTCCACTCAGTAAAATGGGTGG + Intergenic
1024750242 7:52456395-52456417 CTTTGAAACAGTAAAGTGTGGGG - Intergenic
1025249853 7:57344380-57344402 ATCACACAGAGTAAAGTGGGTGG + Intergenic
1027308372 7:76926578-76926600 CTTCCACACAGGACACTGGAAGG - Intergenic
1028511983 7:91635258-91635280 CTTCCACACACAAATTTGGGGGG - Intergenic
1030618526 7:111764061-111764083 ACTCCACACAGTGTAGTGGGCGG - Intronic
1033983708 7:147197061-147197083 CTGCCACACAGAAAAGGAGGGGG - Intronic
1034563487 7:151896118-151896140 CTTCCTCAGTGAAAAGTGGGGGG - Intergenic
1036946122 8:13096472-13096494 TTTCCATACAGTTAAGTGTGTGG + Intronic
1037442654 8:18932296-18932318 TTTGCATTCAGTAAAGTGGGAGG + Intronic
1038995227 8:32915079-32915101 CTTTTACATAGGAAAGTGGGAGG + Intergenic
1040555300 8:48472728-48472750 CTGCCACACAGAAAAGGTGGGGG - Intergenic
1041177818 8:55214782-55214804 CCTTCACACAGCAAAGTGGAGGG - Intronic
1042452192 8:68960575-68960597 CTTCCACACTGTCATGTGGCAGG - Intergenic
1046311898 8:112448344-112448366 CTTCCACATATGAAACTGGGTGG + Intronic
1048080536 8:131121834-131121856 TTTCCCCAGAGGAAAGTGGGAGG - Intergenic
1048730910 8:137439821-137439843 CTTCAACTCAGCAAGGTGGGTGG - Intergenic
1049838709 8:144756088-144756110 TTTTCACACAGAAAAGCGGGGGG - Intronic
1050876522 9:10645044-10645066 CTTTCAAACAATATAGTGGGAGG - Intergenic
1053200873 9:36150861-36150883 TTTCCACACAGGAAAGGAGGTGG + Exonic
1058760095 9:108122229-108122251 CTGCCACACAGAAAAGGTGGGGG - Intergenic
1060232365 9:121835093-121835115 CTTCCCCTCTGTAAAGTGAGGGG + Intronic
1061896031 9:133648144-133648166 CTTGCATACAGAAAAGAGGGAGG - Intronic
1062385284 9:136306928-136306950 CTTCCCCTCTGTAAAGTGGGCGG + Intergenic
1062515800 9:136934893-136934915 TTTCAACACAGGAAATTGGGTGG - Intronic
1187432075 X:19234272-19234294 CTGCCACACAGAAAAGAGGGGGG - Intergenic
1192923648 X:75734136-75734158 CTGCCAAACAGCAAAGTTGGTGG + Intergenic
1194173541 X:90618200-90618222 CTCCCACACAGTGCAGTGGTGGG + Intergenic
1194731445 X:97460178-97460200 CTTCCACACAGGAAAAGGAGGGG + Intronic
1196172286 X:112602647-112602669 GTTGCACACAGTAAAGTGGGTGG + Intergenic
1196710959 X:118762204-118762226 GTTCCACACAAAAAAGTGTGAGG - Intronic
1197319868 X:125015074-125015096 ACTACACACAGTAAAGTGGTTGG + Intergenic
1198868605 X:141152410-141152432 CTTCAACATAGGAAATTGGGGGG + Intergenic