ID: 1117490292

View in Genome Browser
Species Human (GRCh38)
Location 14:56240358-56240380
Sequence CTGGGTAAATGATTGGATGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 351
Summary {0: 1, 1: 0, 2: 3, 3: 36, 4: 311}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117490286_1117490292 8 Left 1117490286 14:56240327-56240349 CCAGAGATGCGTAGGAGGTAGAA 0: 1
1: 0
2: 1
3: 9
4: 84
Right 1117490292 14:56240358-56240380 CTGGGTAAATGATTGGATGTGGG 0: 1
1: 0
2: 3
3: 36
4: 311

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117490292 Original CRISPR CTGGGTAAATGATTGGATGT GGG Intronic
900498168 1:2986015-2986037 ATGGGTGAATGAATGGATGGAGG - Intergenic
900498744 1:2989343-2989365 ATGGATAAATGAGTGGATGATGG - Intergenic
901001267 1:6149966-6149988 ATGGGCAAATGAATGGATGATGG + Intronic
902881856 1:19376819-19376841 CTGAGTAAATAAATCGATGTTGG + Intronic
903823507 1:26123054-26123076 CTGTTTAAATTATTTGATGTAGG + Exonic
904828348 1:33290016-33290038 TTGGATAAAGGATTGGAGGTGGG + Intronic
904894436 1:33803622-33803644 CTTGGTAGCTGATTGGATGTGGG - Intronic
905649004 1:39644205-39644227 CTGGGTGACTGAATGGATGAAGG + Intergenic
905972340 1:42151507-42151529 CTGGGGAAATGGTTGGTTTTAGG + Intergenic
905999344 1:42410484-42410506 CTGGGTAAAGGATGGAATGATGG + Intronic
906176887 1:43782242-43782264 TTGGGAAACTGATCGGATGTGGG - Intronic
906243824 1:44259285-44259307 CTGGCTGACTGATTGGAGGTGGG + Intronic
906400643 1:45501846-45501868 CTTGGTGGCTGATTGGATGTGGG - Intronic
908121937 1:60994122-60994144 CTGAGCAACTGAGTGGATGTTGG + Intronic
908675990 1:66604842-66604864 CTAAGTGAATGATTGGATGTTGG - Intronic
909676299 1:78242240-78242262 CTGGTTAAATCATTGGCTATTGG - Intergenic
910324448 1:85989384-85989406 CTTAGTAAATGATTGGAAGATGG - Intronic
910362755 1:86430562-86430584 CTGGGGAGATGAGAGGATGTGGG + Intronic
910791213 1:91053206-91053228 TTTGGTAACTGATTAGATGTGGG - Intergenic
911020911 1:93386828-93386850 CTGCAGAATTGATTGGATGTGGG - Intergenic
911402305 1:97391419-97391441 CTTGGTTAATCACTGGATGTGGG - Intronic
912674113 1:111661321-111661343 AGGGGGAAAAGATTGGATGTAGG + Intronic
913340054 1:117749753-117749775 CTTGGTAATAGATTGGATGTGGG - Intergenic
916377277 1:164168845-164168867 CTGGGTAAATAATGAGATGAAGG + Intergenic
916554467 1:165882140-165882162 CTGGGTAAATATCTGGAGGTCGG + Intronic
918318517 1:183343174-183343196 CTTGGTGATTGCTTGGATGTGGG - Intronic
918357660 1:183720860-183720882 CTTGGTAATTGATTGGATGTGGG + Intronic
919803283 1:201366213-201366235 CTGGGCAAATAAATGGATCTGGG + Intronic
919973832 1:202598221-202598243 CTGGGTAAATGATGGACTGTGGG + Intronic
920309015 1:205037463-205037485 CTTGTTAAATGAATGTATGTAGG + Intergenic
924016087 1:239724817-239724839 CTTGGTAGTTGATTAGATGTGGG - Intronic
924828745 1:247570447-247570469 CTGGGTAAATAATAAAATGTAGG - Intronic
1062784655 10:252970-252992 GTGGGTATATGATTGAATTTAGG + Exonic
1063698666 10:8363626-8363648 ATGGATGAGTGATTGGATGTGGG + Intergenic
1064550467 10:16495947-16495969 TTGGGCAACTGATTAGATGTTGG - Intronic
1065077179 10:22092170-22092192 CTGGGTAAATAATTAAATGAAGG + Intergenic
1065561407 10:26967801-26967823 CATGGTAAATGATTAGATGTAGG - Intergenic
1066391997 10:34984576-34984598 CTGGTTAAATGATTTGAAATAGG - Intergenic
1067148262 10:43709361-43709383 CCTGGTAAATGCTAGGATGTGGG + Intergenic
1067148303 10:43709585-43709607 CCTGGTAAATGCTAGGATGTGGG + Intergenic
1067148412 10:43710201-43710223 CCTGGTAAATGCTAGGATGTGGG + Intergenic
1068616614 10:59125457-59125479 CTGGGTAAATAATTAGGAGTGGG + Intergenic
1071490654 10:86134316-86134338 GTGAGTAAGTGATTGGATGATGG + Intronic
1071604148 10:86973042-86973064 CTGGCTAAATGATTGCATGGAGG + Intronic
1071785104 10:88890604-88890626 TTGTGTAAGTGATTGGATGTTGG + Intronic
1073698181 10:105893974-105893996 CTGGGGGAAGGGTTGGATGTGGG + Intergenic
1074386736 10:113022478-113022500 CTGGGGAAATGAGTGGGAGTAGG + Intronic
1074758097 10:116642535-116642557 CTGGGAAGATGAATGGATGGAGG - Intronic
1075910303 10:126118965-126118987 CAGGATAAATAATTAGATGTAGG - Intronic
1079251028 11:18788108-18788130 ATTGGTAACTGATTGGATGTAGG - Intronic
1079653749 11:22963146-22963168 CTGGGTAAATAATTAAATGAAGG - Intergenic
1081711651 11:45220473-45220495 ATGGGTAAAAGAATGCATGTGGG - Intronic
1082811164 11:57479879-57479901 CTGGGTAACTGAATAGATGCAGG - Intergenic
1084576524 11:69992156-69992178 GTGGGTAGATGAATGGATGATGG + Intergenic
1084739922 11:71133125-71133147 ATGGGTGAATGAGTGGATGGAGG + Intronic
1084785637 11:71440319-71440341 ATGGGTAAATGGATGGATGACGG + Intronic
1085149132 11:74234065-74234087 CTGGTTTATGGATTGGATGTTGG + Intronic
1087363937 11:97195970-97195992 CTGGGTAAATAATGGAATGAAGG - Intergenic
1087514201 11:99136585-99136607 ATTGGTAAAAGAATGGATGTTGG - Intronic
1087803914 11:102534864-102534886 CTGGGGAGATGATTGGCTGCAGG + Intergenic
1088120227 11:106360553-106360575 CTGGGTAACTGAAAGGATGATGG - Intergenic
1088244863 11:107807913-107807935 CTGAGTAAATGGTTGCAGGTAGG - Intronic
1090199179 11:124842116-124842138 CTAGGTGGCTGATTGGATGTGGG - Intergenic
1090512101 11:127386406-127386428 CTGGGGAAATGCTTGAATGGGGG - Intergenic
1091770657 12:3149004-3149026 CTGGGTAAATTGTGGGGTGTGGG + Intronic
1091805427 12:3352609-3352631 CTTGGTAAAGCATTGCATGTTGG - Intergenic
1092720974 12:11440175-11440197 CTTGGTGACTGATTAGATGTGGG + Intronic
1092844579 12:12572177-12572199 CTGAGCAAATGAGTGGATGGTGG + Intergenic
1092910229 12:13139825-13139847 CGGGATAAGGGATTGGATGTGGG - Intronic
1092910241 12:13139873-13139895 CTGGATGAGGGATTGGATGTAGG - Intronic
1092910320 12:13140233-13140255 CGGGATAAGGGATTGGATGTGGG - Intronic
1092910327 12:13140257-13140279 CGGGATAAGGGATTGGATGTAGG - Intronic
1092910344 12:13140328-13140350 CCGGGTGAGGGATTGGATGTAGG - Intronic
1092910466 12:13140860-13140882 CTGGATGAGGGATTGGATGTGGG - Intronic
1093089479 12:14905175-14905197 CTGGGGCAATCATTGCATGTTGG + Intronic
1095126820 12:38489083-38489105 CGGGGCACATGACTGGATGTGGG - Intergenic
1095518158 12:43029846-43029868 CTTGATAACTGATTGGATTTGGG + Intergenic
1096794413 12:54066415-54066437 CTGGGTAAATGATTTGCTTCAGG - Intergenic
1096929944 12:55196706-55196728 ATGGATACATGATTGGATGTGGG + Intergenic
1097031135 12:56090299-56090321 CTGGGTAAAAGAGTGTATGGGGG - Intronic
1097049604 12:56214143-56214165 TTGGATAAATGAATGGATCTTGG - Intronic
1097638150 12:62146534-62146556 CTTGGGAAATGACTGGAGGTAGG + Intronic
1098126512 12:67300352-67300374 CTGGATTAAAGATAGGATGTGGG - Intronic
1098606291 12:72394804-72394826 CTGGCTACCTGACTGGATGTAGG + Intronic
1099875221 12:88395896-88395918 TTGGGTAAATGATGAGATTTAGG + Intergenic
1101341907 12:103849603-103849625 CTTGGTGCTTGATTGGATGTGGG - Intergenic
1101834721 12:108287312-108287334 GTGGGTGGATGAGTGGATGTTGG + Intergenic
1103243507 12:119435079-119435101 CTGGCTAATGGATTGGATGTGGG + Intronic
1103405574 12:120672673-120672695 CTGACTAAATGATAGTATGTAGG + Intergenic
1104058658 12:125249733-125249755 CTGGGTGACTGATTAGATGAAGG + Intronic
1104499006 12:129266750-129266772 TTGGGCAATGGATTGGATGTAGG - Intronic
1105771343 13:23615180-23615202 TTGTGGAAATGATTGTATGTGGG + Intronic
1105855075 13:24365427-24365449 CCGGGGAAATGAATGGATGCTGG - Intergenic
1106800610 13:33252732-33252754 CTTGCTAAATGATTTGATGTGGG - Intronic
1108287794 13:48925845-48925867 CTGGTGAATTGATTGGATGTGGG + Intergenic
1108566790 13:51707490-51707512 CTGGGTATATAATTCTATGTTGG - Intronic
1108569725 13:51737395-51737417 ATGGGCAAATGATTGAATGAAGG - Intronic
1108725243 13:53173692-53173714 TTGGGTAATTGAGTAGATGTTGG - Intergenic
1108989483 13:56637397-56637419 GTGGGAACATGATTGGATCTAGG - Intergenic
1109108973 13:58292097-58292119 CTGAGAAAAAGATTGGATATGGG + Intergenic
1109283344 13:60382387-60382409 CTGGATAACTGATTGGATATAGG - Intergenic
1110139257 13:72107187-72107209 CTGGGGAAAGGATGGGAGGTGGG - Intergenic
1112399022 13:99059414-99059436 TTGGGTAATTGATTAGATGTAGG - Intronic
1112729238 13:102341381-102341403 ATGGGTAGATGAATGGATGATGG - Intronic
1113245536 13:108390822-108390844 TTGGGTAATTGATCGGATGCTGG - Intergenic
1113311040 13:109133171-109133193 CTGCGTACATGAGTGGATGTAGG - Intronic
1113514550 13:110883161-110883183 CTGGGTAAAAGATTCCATGCTGG + Intronic
1114307831 14:21439388-21439410 CTTGGCAAATGATTGGATGGTGG - Intronic
1114614032 14:24059014-24059036 ATGGGTGAATGATGGGATGAGGG - Intronic
1114840347 14:26255818-26255840 CTTGGTAATTGATTAGATTTGGG - Intergenic
1115742773 14:36405668-36405690 CTTGATAATTGATTGGATGGTGG - Intergenic
1116417433 14:44695813-44695835 CTGGGTAAATAACAGGATGAAGG + Intergenic
1117490292 14:56240358-56240380 CTGGGTAAATGATTGGATGTGGG + Intronic
1118430098 14:65709518-65709540 CTGGATAATTGTTTGGTTGTGGG + Intronic
1121502225 14:94447360-94447382 CTTGGTCATTGATTGGGTGTGGG - Intronic
1121643824 14:95504183-95504205 CTATGTAAATGAATGGGTGTTGG - Intergenic
1121817142 14:96937545-96937567 CTCGACAACTGATTGGATGTGGG - Intergenic
1122011540 14:98753092-98753114 ATGGGTGAATGAATGGATGATGG + Intergenic
1123058869 14:105585504-105585526 GTGGGTAAATGGCTGGATGGAGG - Intergenic
1123083199 14:105705750-105705772 GTGGGTAAATGGCTGGATGGAGG - Intergenic
1126937670 15:53729156-53729178 CTGAGAAACTGATTGGATGTAGG - Intronic
1127124785 15:55801384-55801406 CTGGGTAAAGAACTGGAAGTGGG - Intergenic
1127303684 15:57681940-57681962 CCTGGTGAATGACTGGATGTGGG + Intronic
1128011506 15:64301146-64301168 CTTGGTAAATGCTTGGATAGGGG - Intronic
1128211264 15:65904553-65904575 TTGGGGAGATGATTAGATGTGGG - Intronic
1129103337 15:73286788-73286810 CTTGGTAAATAAATGGATGTAGG - Intronic
1129464902 15:75718756-75718778 CTTGGCAATTGGTTGGATGTGGG + Intergenic
1129857789 15:78837405-78837427 CTGGGTGAATGAATGAATGGCGG + Intronic
1131647206 15:94358258-94358280 GTGGATAAATTATTGGATCTGGG + Intronic
1132074958 15:98812247-98812269 CTGAGTCAATGACTGGAGGTAGG + Intronic
1133111591 16:3551177-3551199 GTGGGTAGATGAGTGGATGGAGG - Intronic
1133502491 16:6379094-6379116 CTGGGTATTTGAGTGGATGGGGG + Intronic
1135086494 16:19478794-19478816 ATGGGTAAATGGATGGATGATGG - Intronic
1135359051 16:21795875-21795897 CTTGGGAAGTGATTGGATATAGG - Intergenic
1135457603 16:22612312-22612334 CTTGGGAAGTGATTGGATATAGG - Intergenic
1135899862 16:26447438-26447460 CAGGGAGAATGATTGGATCTTGG - Intergenic
1135980108 16:27140696-27140718 TTGGGTAACTGTATGGATGTAGG - Intergenic
1138318068 16:56087403-56087425 CTTGTTAATTGAATGGATGTTGG + Intergenic
1138982816 16:62291387-62291409 CTGGGTAAAGAATTTCATGTAGG - Intergenic
1139094391 16:63686699-63686721 CTGGGTAAATTATTGTTGGTTGG - Intergenic
1139501179 16:67367181-67367203 TTGAGTAAATGCCTGGATGTGGG + Exonic
1139928064 16:70502698-70502720 CAGGATAAATGAATGGGTGTAGG - Intronic
1140185845 16:72770927-72770949 CTGGGTATAGGATTCTATGTTGG + Intergenic
1141066043 16:80914909-80914931 CTGGCCAAATGATTGGTTGAAGG - Intergenic
1143114230 17:4572682-4572704 CTAGGAAAATGCTTGGTTGTTGG - Intergenic
1143171098 17:4930929-4930951 TTAGGTAAATGAGTGGATGATGG + Intergenic
1143590549 17:7884170-7884192 CTGGGTAAAGGCTTGGAGATGGG + Intronic
1143692434 17:8580556-8580578 CTGAGTCAATGAATGAATGTAGG + Intronic
1144117107 17:12107111-12107133 CTTGTTAAATGACTGGATGCTGG - Intronic
1144196694 17:12901575-12901597 CTTGGTAACTGAGTGGATGTGGG + Intronic
1148345941 17:46903825-46903847 GTGGGTAGATGAGTGGATGATGG + Intergenic
1148874750 17:50680331-50680353 CTGGGCAAAGGAGTGGAGGTGGG + Intronic
1150170672 17:62990685-62990707 CTGGGTGAATGAGTGGGAGTGGG + Intergenic
1151270991 17:72995906-72995928 CTTGGTAACCAATTGGATGTGGG - Intronic
1151292389 17:73159890-73159912 CTTGGATAATGATGGGATGTAGG + Intergenic
1151502514 17:74500424-74500446 CAGGCTGAAGGATTGGATGTGGG + Intergenic
1151537032 17:74744926-74744948 CAGGGTAAGTGATTGTCTGTGGG + Exonic
1155704989 18:28798787-28798809 CTTGGTAACTGATTGGATGTAGG + Intergenic
1156178301 18:34573532-34573554 CTGGGTAAAGGACTGGATAAAGG + Intronic
1157307369 18:46526870-46526892 CCTGGCAATTGATTGGATGTGGG + Intronic
1159299087 18:66539062-66539084 CTGGGTAAATGCTTGGAAGAGGG + Intronic
1161090332 19:2357005-2357027 TTGGATAAATGAGTGGATGGAGG - Intergenic
1161934492 19:7363260-7363282 CTGGGTGGATGAATGGATGACGG + Intronic
1163382642 19:16978973-16978995 ATGGATAGATGATTGGATGGTGG - Intronic
1163571336 19:18084048-18084070 ATGGGTAAATGGGTGGATGGTGG - Intronic
1164426421 19:28145937-28145959 CTTGCAAACTGATTGGATGTGGG - Intergenic
1164511811 19:28903807-28903829 CTGGCTCAATGAATGCATGTTGG - Intergenic
1165476019 19:36031567-36031589 CTGGGTAAAGGATCTGAGGTAGG - Intronic
1166646865 19:44538731-44538753 GTTGGTGATTGATTGGATGTTGG - Intergenic
1168497894 19:56869516-56869538 CTGGGGAAATGAAAGGAAGTGGG - Intergenic
925737442 2:6976107-6976129 CTGGGCACATGACTGGAAGTGGG + Intronic
925793485 2:7518034-7518056 CAGGGTAACTGATTTAATGTGGG + Intergenic
930590607 2:53322289-53322311 TTGGATGATTGATTGGATGTGGG - Intergenic
931303682 2:61006980-61007002 GAAGGTAAATGATTGAATGTGGG - Intronic
931971509 2:67591807-67591829 CTGGGTAAATAATTAAATGAAGG + Intergenic
932557690 2:72839957-72839979 CTTGGTTCATTATTGGATGTAGG - Intergenic
932881875 2:75509291-75509313 CTGTGTAAATGACTGAATTTTGG + Intronic
932930660 2:76034145-76034167 CTTGGTGATTGATTGGATCTAGG - Intergenic
933122110 2:78551614-78551636 CTTGGCAAGTGATTAGATGTGGG + Intergenic
936584866 2:113747649-113747671 GTTGGCAAATGATGGGATGTTGG + Intronic
937429527 2:121826553-121826575 CTGGGTAATTGAATGGATCAGGG - Intergenic
937566405 2:123295031-123295053 CTGTGTAAATGATTGGCGTTTGG - Intergenic
939849783 2:147290736-147290758 TTGGGTAACTGATTTAATGTGGG - Intergenic
940133910 2:150414488-150414510 CTGGACAATTGATTGGATATGGG + Intergenic
940952140 2:159687368-159687390 CTGGGGAAAGGATTGAATGTTGG - Intergenic
941089168 2:161154642-161154664 TTGGGTGACTGATTGAATGTTGG + Intronic
941908780 2:170742485-170742507 ATTGGTGAATGATTGGATGTGGG + Intergenic
942454314 2:176127734-176127756 CTGGATAAATGAGTGGATTTTGG - Intergenic
942677224 2:178440597-178440619 CATGGTAATTGATTGGATGTGGG - Intronic
943782393 2:191838777-191838799 CTTGTTAAATGAGTGCATGTTGG + Intronic
943854252 2:192768217-192768239 TTTGGTAAATGATTTGTTGTAGG + Intergenic
944703631 2:202266808-202266830 CTGGCTAATAGATTGAATGTGGG + Intronic
945054889 2:205859833-205859855 CTGGATGAATGATTGAATGATGG + Intergenic
945191875 2:207197055-207197077 TTGGCCAAATGATTGGATATTGG - Intergenic
945897284 2:215497867-215497889 TGGAGTAAATGATTGGATATTGG - Intergenic
946683564 2:222243794-222243816 CTGGGTCAATTATTGCTTGTTGG + Intronic
1168982586 20:2020501-2020523 CTTGGTAAATGATTAGCTGTCGG + Intergenic
1169796098 20:9464180-9464202 CTGGGTAAATAATGGAATGAAGG + Intronic
1170329569 20:15193716-15193738 CTGGGGAAATGAGAGGATGAGGG - Intronic
1171227085 20:23451028-23451050 ATGGGTAAATGGATGGATGGGGG - Intronic
1172798296 20:37558590-37558612 CTGGGAGCCTGATTGGATGTGGG + Intergenic
1173823630 20:46033710-46033732 ATGGGTGAATGGTTGGATGATGG - Intronic
1173859891 20:46276436-46276458 GTGGGCGATTGATTGGATGTAGG + Intronic
1176047150 20:63098702-63098724 ATGGATAAATGAATGGATGATGG + Intergenic
1178071490 21:28973014-28973036 CTGAGTACAGGATTGTATGTTGG - Intronic
1178174298 21:30078395-30078417 CTTGCTAAATGATTTCATGTAGG + Intergenic
1178366416 21:31992345-31992367 CTGGGTAAATGATTGTTCATGGG + Intronic
1181525762 22:23485102-23485124 ATGGCTGAATGATTCGATGTAGG + Intergenic
1181785554 22:25224177-25224199 CATGGTTAATGCTTGGATGTGGG + Intronic
1182039062 22:27222259-27222281 ATGGGTGAATGAATGGATGATGG + Intergenic
1184414770 22:44345823-44345845 CTGGGTGAATGATGGGTGGTGGG + Intergenic
1185193455 22:49453204-49453226 ATGGGTGGATGAATGGATGTGGG + Intronic
949427877 3:3939103-3939125 CTGGGTAAATAATTAAATGAAGG - Intronic
949840441 3:8314223-8314245 CTGTGGAACTGATTGGATGCTGG - Intergenic
951433977 3:22640841-22640863 CTGGGTAAATAATTAAATGAAGG - Intergenic
952165248 3:30741364-30741386 CTGGTTAAATGTGGGGATGTAGG - Intronic
952933782 3:38379694-38379716 CTGGGGACATGAATGGATCTTGG + Intronic
956471684 3:69573669-69573691 TTGGGTAAATTATTGGATCACGG - Intergenic
956747976 3:72324417-72324439 CTGAGTGAATGAAGGGATGTTGG - Intergenic
956851410 3:73231420-73231442 CTTGGAAAATGCTTGGATATAGG + Intergenic
957933962 3:86918514-86918536 CCTGGTCAATGATTGCATGTAGG - Intergenic
959228434 3:103616462-103616484 CTGGATAACTCATTGGATGTTGG + Intergenic
962695642 3:137944708-137944730 CTTGTTAAATCACTGGATGTTGG + Intergenic
964982809 3:162707041-162707063 CTTGGGAATTGATTGGATTTGGG + Intergenic
966494053 3:180559546-180559568 CTGGGTAAATGATGAAATGAAGG + Intergenic
966815768 3:183888581-183888603 CAAGCTAAAAGATTGGATGTTGG + Intergenic
966916826 3:184588981-184589003 CTTGGTGACTGATGGGATGTGGG + Intronic
967075741 3:186000213-186000235 CTTGGTTATTGATTGGCTGTAGG - Intergenic
969624393 4:8294959-8294981 ATGGGTAAATGGATGGATGATGG - Intronic
970460799 4:16272930-16272952 CTGGGTGAGTGTTTGAATGTGGG + Intergenic
971960824 4:33485003-33485025 CTGGGGAAATATTTGTATGTAGG + Intergenic
972429157 4:38964020-38964042 CTTGGTAAGTGATTTGATGCAGG - Intergenic
973170935 4:47142733-47142755 ATTGGTAATTGATAGGATGTGGG + Intronic
973965580 4:56158969-56158991 CAGGGAAAATGATTTGAAGTTGG - Intergenic
975593186 4:76020483-76020505 CTTAGTAAGTAATTGGATGTGGG + Intronic
975593196 4:76020549-76020571 TTGGGAAACTGATTGGATGATGG + Intronic
975687605 4:76933114-76933136 CTGGCTCAGTCATTGGATGTGGG - Intergenic
976178676 4:82379048-82379070 GTTGGTGATTGATTGGATGTGGG - Intergenic
978463192 4:108980337-108980359 CTGGTTAACTGATTGGACATGGG + Intronic
978711813 4:111791441-111791463 CAGAGTAAATGATTAAATGTTGG - Intergenic
979596317 4:122538461-122538483 TTGGGTAAAGGTTTGGATTTAGG + Intergenic
983153404 4:164313819-164313841 CTTGGTAATGGATTGAATGTGGG - Intronic
983550635 4:169013945-169013967 CTTTGTGACTGATTGGATGTGGG - Intergenic
986257742 5:6114680-6114702 TTGGAGAAATGATTGGATCTTGG + Intergenic
987200391 5:15571393-15571415 CTGGGAAAATGAAGAGATGTAGG + Intronic
988097269 5:26632607-26632629 CAGAGTTCATGATTGGATGTTGG - Intergenic
989363997 5:40635006-40635028 CTGGGGAAAGGAGTGGCTGTGGG + Intergenic
989508600 5:42257476-42257498 CTGGGTAAATAATTAAATGAAGG - Intergenic
990556403 5:56941017-56941039 CTGAGTAAATGATGGGAAGGTGG - Intronic
991248641 5:64534581-64534603 CTGAGTAACTGATTTGATGGTGG + Intronic
991273478 5:64814934-64814956 CATGGTAACAGATTGGATGTAGG + Intronic
992422503 5:76620573-76620595 CTGGTTAGAAGACTGGATGTGGG + Intronic
992839123 5:80669327-80669349 CTGGGTAAATTTTTAGAAGTTGG + Intronic
993379246 5:87187079-87187101 CTTGGTAATTGATTTGATGTGGG - Intergenic
993462737 5:88204465-88204487 CTGGGTAAACCATCGGATGTGGG + Intronic
993782334 5:92082788-92082810 TTTGGCAAATGACTGGATGTTGG + Intergenic
994524882 5:100893071-100893093 TTGGGTCAGTGATTGGGTGTGGG - Intronic
994914328 5:105953936-105953958 TTGGGTAAAATATAGGATGTCGG + Intergenic
998047934 5:139004947-139004969 TGGGGTAAAAGATAGGATGTCGG + Intronic
998048728 5:139012460-139012482 ATGGGTAAAAGATAGGATGTCGG - Intronic
998614080 5:143720339-143720361 CTTGACAACTGATTGGATGTGGG + Intergenic
998785494 5:145704329-145704351 CTTGGTATATCATTGGAAGTTGG - Intronic
998856351 5:146398675-146398697 ATGGGCAAAGGATTGGAGGTGGG - Intergenic
1000534681 5:162465155-162465177 CTGGGTAAATGATGAAATGAAGG - Intergenic
1000546141 5:162605331-162605353 CAGGGTGAAAGATTGGATATGGG + Intergenic
1001708977 5:173762687-173762709 CTGGGTATCTGAGGGGATGTGGG + Intergenic
1002367078 5:178721948-178721970 CTTGGTAATTGATTAGATGAGGG - Intronic
1002406395 5:179036754-179036776 CTGGAGAAATGATTGCATGTGGG + Intergenic
1002472294 5:179442768-179442790 GTGGGTGAATGAATGGATGAAGG + Intergenic
1002472321 5:179442930-179442952 GTGGGTGAATGAATGGATGAAGG + Intergenic
1002788594 6:422791-422813 CTCTGTAAATGATTACATGTTGG + Intergenic
1003350178 6:5309254-5309276 CTTAGTAATGGATTGGATGTGGG + Intronic
1003609176 6:7592889-7592911 CTAGGTGATTGATTGGACGTGGG + Intronic
1003727636 6:8783575-8783597 CTGGGTAAAGGCTGGGAGGTGGG - Intergenic
1003965015 6:11244465-11244487 CTTGGCAGCTGATTGGATGTGGG - Intronic
1004142281 6:13029389-13029411 ATGGGGAATTGATTGGAAGTGGG + Intronic
1005715333 6:28542071-28542093 CTGGGTAAGTGATGGGACATGGG + Intergenic
1005939744 6:30552164-30552186 CTGAGTAAAAGAATGGATGACGG - Intronic
1009052133 6:58288987-58289009 CTTGTTAATGGATTGGATGTGGG + Intergenic
1010689422 6:78891341-78891363 GTAGGTGAATGAATGGATGTGGG + Intronic
1012602211 6:101112618-101112640 ATTGTTAAATGCTTGGATGTGGG + Intergenic
1014904547 6:127010526-127010548 CTTGGTGAATTATTTGATGTGGG + Intergenic
1014950415 6:127547819-127547841 CTGGGTAAATCATTGTCTCTAGG + Intronic
1015711375 6:136144989-136145011 GTGGGTAAATGCTTTGATATTGG + Intronic
1016062505 6:139645427-139645449 CTTAGTAAGTGACTGGATGTGGG - Intergenic
1016618757 6:146082573-146082595 CTTGGTGATTGATTGGATATGGG - Intronic
1017591061 6:155978431-155978453 CTGAGTAGATGGATGGATGTTGG + Intergenic
1018832455 6:167454313-167454335 ATGAGTAAATGAGTGGATGAGGG - Intergenic
1020081574 7:5288880-5288902 GTGGGTAAAGGATGGGAGGTAGG - Intronic
1020577816 7:9956577-9956599 CTTGACAAATGATTGGATATTGG - Intergenic
1023150142 7:37194378-37194400 CTTGGTAACAGATTGGATATGGG - Intronic
1026077275 7:67183738-67183760 CTGGGTAAATGATATAATTTTGG - Intronic
1026450625 7:70526094-70526116 CTGGGTGACTCATTAGATGTGGG - Intronic
1026699594 7:72628363-72628385 CTGGGTAAATGATATAATTTTGG + Intronic
1028383704 7:90228466-90228488 CTGGGCAAATGACTGGAAGGAGG - Intronic
1028965493 7:96797158-96797180 CTTGGCAACTGATTGGATGTGGG - Intergenic
1029586331 7:101474178-101474200 GTGGTTAAGTGATTGGATGAAGG + Intronic
1029892057 7:103940763-103940785 CTGGGTGATTGATTGGATAATGG + Intronic
1030105642 7:105984713-105984735 GTAGGTAAATGCTTGGATTTGGG - Intronic
1032141308 7:129333090-129333112 CTTGGAAAATGAATGGTTGTAGG + Intronic
1032926516 7:136612218-136612240 CTGGGTAAATAATTAAATGAAGG - Intergenic
1033893146 7:146040200-146040222 CTGGGTAAATAATGAAATGTAGG - Intergenic
1034735334 7:153424039-153424061 GTAGGTAAATGGTAGGATGTGGG + Intergenic
1035078451 7:156197027-156197049 ATGGGTAGATGCTTGGATGTGGG - Intergenic
1035136000 7:156703653-156703675 CTGGGAAAATGCTTGGGTGAGGG - Intronic
1039152655 8:34524464-34524486 CAGGGTAAAGGATAGGATTTAGG - Intergenic
1040662530 8:49592408-49592430 TTGGGTAAATAATTAGAAGTGGG + Intergenic
1041211121 8:55552074-55552096 TTTGGTAATTGATTGGATGTTGG - Intergenic
1041383123 8:57273051-57273073 CTGGGGAAAGGGTTGGCTGTGGG - Intergenic
1042157087 8:65855964-65855986 CTTTGTAACTGATTGGATGTGGG - Intergenic
1042413218 8:68488569-68488591 CTTGCTAATGGATTGGATGTGGG + Intronic
1043703664 8:83322332-83322354 CTGGGTAAAGGGGTGGCTGTGGG + Intergenic
1043851297 8:85219780-85219802 CTAGATGAATGATTGGATTTTGG - Intronic
1045211344 8:100103378-100103400 CTTGGTAAATGATTGCAGGCAGG + Intronic
1045401841 8:101827073-101827095 CTGGGTCAAAGATATGATGTTGG + Intronic
1046547812 8:115673665-115673687 ACTAGTAAATGATTGGATGTGGG - Intronic
1046661659 8:116954088-116954110 TTTGGTAAGTAATTGGATGTGGG + Intronic
1047202475 8:122779328-122779350 CTGGGTGACAGATTGTATGTAGG - Intergenic
1048778342 8:137972721-137972743 CTTGGTGATGGATTGGATGTAGG - Intergenic
1050799024 9:9585658-9585680 CTTGAAAAATGATTGGATGAAGG - Intronic
1051542358 9:18234104-18234126 CTTGCTAAAGGTTTGGATGTGGG + Intergenic
1051595698 9:18822553-18822575 GTGGGTTACTGATTGGCTGTAGG + Intronic
1053015430 9:34659273-34659295 CTGGGTATATGAGTGTTTGTAGG - Intronic
1054848175 9:69819447-69819469 CTGGGTAAGTGATTGCAAGGAGG + Intergenic
1054892154 9:70262422-70262444 CTTGGTGATTGATTGGATGATGG + Intronic
1054953170 9:70876780-70876802 CTGGGTAAAGAATGGGTTGTGGG - Intronic
1056515527 9:87345734-87345756 CTTGGTGACTGATAGGATGTAGG - Intergenic
1058057559 9:100464415-100464437 CTTGGTAACTGACTAGATGTGGG - Intronic
1058620506 9:106878095-106878117 GTGGGAAAGTGATTGGCTGTGGG + Intronic
1059452414 9:114378716-114378738 GTGGGTAGATGGATGGATGTTGG - Intronic
1061850166 9:133410288-133410310 ATGGGCAAATGCCTGGATGTTGG - Intronic
1186654479 X:11598118-11598140 CTTGATAACTGATTGGATGTAGG + Intronic
1187164350 X:16790905-16790927 CTGGGTAAATCTATGGATTTTGG + Intronic
1187490740 X:19748822-19748844 CTGGGTAATTGGGTGGATGATGG - Intronic
1189334522 X:40162680-40162702 ATGGGAAAATGATTAGATTTTGG + Intronic
1189893419 X:45629122-45629144 GAGGGCAAATGATTGTATGTAGG + Intergenic
1191611652 X:63121833-63121855 CTGGGGAAATCAGTGGTTGTAGG - Intergenic
1191790290 X:64964543-64964565 CTGGGTAAATAATTCTATATTGG - Intronic
1192143124 X:68661737-68661759 CAAAGTAAATGATAGGATGTGGG - Intronic
1192446468 X:71215083-71215105 CTTGTTTAATGATTGTATGTGGG + Intergenic
1192766632 X:74146628-74146650 CTGGCAAAGTGATTGGATGGTGG - Intergenic
1193358578 X:80552993-80553015 CTGGGCCAATGATTGGACATAGG - Intergenic
1193654483 X:84183266-84183288 TTTGGTAACTGATTAGATGTTGG - Intronic
1193961827 X:87935737-87935759 GTGGATAAATGATTTGATATGGG + Intergenic
1195035678 X:100969936-100969958 CTGGGAAAATGATTGAATTAGGG - Intronic
1195277535 X:103296936-103296958 TTTGGCAATTGATTGGATGTTGG - Intergenic
1195700878 X:107704718-107704740 CTGGGTAATGGATTGGATGTAGG + Intergenic
1196196217 X:112840812-112840834 CTGGGCAAAGGATGGGAGGTAGG + Intronic
1196887405 X:120261255-120261277 TTTGGCAATTGATTGGATGTGGG - Intronic
1197769459 X:130080999-130081021 CTGGCTCAATGATTGCATGTGGG + Intronic
1201144715 Y:11057967-11057989 ATGGGTGAATGAGTGGATGGAGG + Intergenic