ID: 1117490388

View in Genome Browser
Species Human (GRCh38)
Location 14:56241055-56241077
Sequence GGTCCAGTTTCCAGTGTTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 134}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117490388_1117490390 -5 Left 1117490388 14:56241055-56241077 CCTGGAACACTGGAAACTGGACC 0: 1
1: 0
2: 1
3: 9
4: 134
Right 1117490390 14:56241073-56241095 GGACCAGTATCATCCCCAGGAGG 0: 1
1: 0
2: 1
3: 9
4: 101
1117490388_1117490389 -8 Left 1117490388 14:56241055-56241077 CCTGGAACACTGGAAACTGGACC 0: 1
1: 0
2: 1
3: 9
4: 134
Right 1117490389 14:56241070-56241092 ACTGGACCAGTATCATCCCCAGG 0: 1
1: 0
2: 0
3: 3
4: 86
1117490388_1117490395 16 Left 1117490388 14:56241055-56241077 CCTGGAACACTGGAAACTGGACC 0: 1
1: 0
2: 1
3: 9
4: 134
Right 1117490395 14:56241094-56241116 GGTTTGAGTATTCTTCTCTGAGG 0: 1
1: 0
2: 1
3: 13
4: 167

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117490388 Original CRISPR GGTCCAGTTTCCAGTGTTCC AGG (reversed) Intronic