ID: 1117490388

View in Genome Browser
Species Human (GRCh38)
Location 14:56241055-56241077
Sequence GGTCCAGTTTCCAGTGTTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 134}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117490388_1117490390 -5 Left 1117490388 14:56241055-56241077 CCTGGAACACTGGAAACTGGACC 0: 1
1: 0
2: 1
3: 9
4: 134
Right 1117490390 14:56241073-56241095 GGACCAGTATCATCCCCAGGAGG 0: 1
1: 0
2: 1
3: 9
4: 101
1117490388_1117490389 -8 Left 1117490388 14:56241055-56241077 CCTGGAACACTGGAAACTGGACC 0: 1
1: 0
2: 1
3: 9
4: 134
Right 1117490389 14:56241070-56241092 ACTGGACCAGTATCATCCCCAGG 0: 1
1: 0
2: 0
3: 3
4: 86
1117490388_1117490395 16 Left 1117490388 14:56241055-56241077 CCTGGAACACTGGAAACTGGACC 0: 1
1: 0
2: 1
3: 9
4: 134
Right 1117490395 14:56241094-56241116 GGTTTGAGTATTCTTCTCTGAGG 0: 1
1: 0
2: 1
3: 13
4: 167

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117490388 Original CRISPR GGTCCAGTTTCCAGTGTTCC AGG (reversed) Intronic
900196953 1:1381323-1381345 GCTCCAGTTGCCAGAGCTCCAGG + Intergenic
900350712 1:2233241-2233263 GGTCCTGTTCCCAGAGGTCCGGG + Intronic
900637044 1:3671149-3671171 TGTCCAGGTTTCAGGGTTCCAGG + Intronic
901217536 1:7563107-7563129 TGTCCAGTGTCCAGGGTCCCTGG + Intronic
901336239 1:8451536-8451558 GTACAAGTTTCCAGTGTCCCAGG - Intronic
903360590 1:22774540-22774562 GGTCAAGTCACCAGTGTTCAGGG + Intronic
905769076 1:40625755-40625777 GGTCTTGGTTCCAGGGTTCCTGG - Exonic
916429399 1:164712665-164712687 AGCCCAGCTTCCAGTGCTCCGGG + Intronic
917465071 1:175268992-175269014 GATCCAGTTTCCAGGGCTCATGG + Intergenic
918670950 1:187216119-187216141 TGTACAGTTTCCAGTGTTTCAGG - Intergenic
923533108 1:234827328-234827350 GCTCAAGTCTCCAGTGTCCCTGG + Intergenic
924197647 1:241624729-241624751 GAAGCAGTTACCAGTGTTCCTGG + Intronic
924253831 1:242162211-242162233 GTTCCTGCTTCCAGTGTTCCTGG - Intronic
1072331431 10:94357248-94357270 GGTGCAGTTTGCAGAGTTCTTGG + Exonic
1073535102 10:104269214-104269236 GGTCCGGTTGCCCGAGTTCCCGG + Exonic
1074249378 10:111729326-111729348 GGTCCTGTATCCAGTGTTTCAGG + Intergenic
1074732585 10:116394100-116394122 GGTCCATTTTACAGAGCTCCGGG - Intergenic
1077605213 11:3605780-3605802 GTGCCAGGTTCCAGTGTGCCAGG + Intergenic
1077605220 11:3605816-3605838 GTGCCAGGTTCCAGTGTGCCAGG + Intergenic
1081106773 11:39079573-39079595 GGTCCTGTTTCCAGAATTCATGG - Intergenic
1081289993 11:41312960-41312982 GGGCCATTTTGCAGTGGTCCTGG + Intronic
1081365238 11:42226934-42226956 TGTTCAGTGTTCAGTGTTCCTGG + Intergenic
1083938252 11:65881570-65881592 GGTCCAGCTGCCAGTGTCCCTGG - Intronic
1086585163 11:88443043-88443065 GGTGCAGTCTCCAGTCCTCCTGG + Intergenic
1086605552 11:88692040-88692062 TGTGCAGCTTCCAGTGTTTCTGG - Intronic
1089377064 11:118002002-118002024 GGCCCAGTTTGCTGTCTTCCTGG - Intergenic
1091683189 12:2541464-2541486 GATCCAGTGTCCAGGCTTCCCGG - Intronic
1093068550 12:14684736-14684758 GGTCAAGGCTCCAGTGATCCAGG - Intronic
1096063647 12:48722809-48722831 GTTCCAGTTTCCAGTCTGACAGG + Intergenic
1100760596 12:97802713-97802735 GTTCCAGTTTACAGTGTTACTGG + Intergenic
1102299342 12:111759544-111759566 GGTCCATCTTCTAGTGTTGCTGG + Intronic
1102430353 12:112878244-112878266 GGAGCAGTAGCCAGTGTTCCAGG - Intronic
1102806646 12:115787311-115787333 GCTCCACTTTCCCGAGTTCCAGG + Intergenic
1108809023 13:54197702-54197724 TGTCCAGAATTCAGTGTTCCAGG - Intergenic
1112832020 13:103464767-103464789 GGTCCAGGCCTCAGTGTTCCTGG + Intergenic
1115193024 14:30767688-30767710 GGTCAAGTGTCCAGTGGTTCAGG - Intergenic
1117490388 14:56241055-56241077 GGTCCAGTTTCCAGTGTTCCAGG - Intronic
1117963352 14:61183555-61183577 CGTCCAATTTCCATTTTTCCCGG - Intergenic
1118772583 14:68952102-68952124 GGTTCAGTCTCCAGCTTTCCGGG + Intronic
1119357011 14:74015915-74015937 TGTCCAGTTTTCCTTGTTCCTGG - Exonic
1119600586 14:75973676-75973698 GGTCCAGATTGCAGTGAGCCAGG + Intronic
1122451966 14:101816260-101816282 GGTCCTATTTCCAGTGTGACAGG - Intronic
1124999253 15:34754270-34754292 GGTCAAGGCTCCGGTGTTCCCGG - Intronic
1125361853 15:38872956-38872978 GGTCCAGTTTCCAGCTCTGCAGG - Intergenic
1128639985 15:69328914-69328936 GGACCAGTTTCCAGTTTCCAGGG + Intronic
1128821028 15:70653737-70653759 GGTTCAGTTTCCAGTTTAGCGGG + Intergenic
1131842766 15:96455086-96455108 GGTCCAAATTCCATTGGTCCAGG + Intergenic
1132572551 16:650319-650341 GCTCCAGTTTCCCTTGGTCCTGG + Exonic
1132639844 16:972774-972796 GTTCCAGCTTCCAGCGCTCCGGG + Intronic
1133088473 16:3384486-3384508 GGTCTAGTTTCCTGACTTCCTGG + Exonic
1135658551 16:24273800-24273822 GGTACAGTTTTCATTTTTCCTGG + Intronic
1137616545 16:49851546-49851568 GCTCCAGTTTCCTGCCTTCCTGG + Intronic
1139945125 16:70635590-70635612 GGAGCTGTTTCCAGTGTTCAAGG + Intronic
1141571179 16:84934428-84934450 GCTCCAGTGTCCACTGTTTCTGG - Intergenic
1141886349 16:86895036-86895058 CTTCCAGCTTCCAGTGTCCCTGG - Intergenic
1143320551 17:6065938-6065960 TGTCCAGTTTCCAGTCTTCATGG - Intronic
1143483449 17:7239605-7239627 GGTCCCTTTTCCGCTGTTCCCGG - Intronic
1144412420 17:15013973-15013995 GGTCCAGTGTCCATTATCCCTGG - Intergenic
1145347348 17:22049390-22049412 GGTCCAGTTCCCAGGGATTCTGG - Intergenic
1145416238 17:22715943-22715965 GGTCCAGTTCCCAGGGATTCTGG + Intergenic
1146124050 17:30218186-30218208 GGTGCAGTTGCCAGTGTTCCAGG + Exonic
1150060478 17:62065037-62065059 GGTCCAGATGCCCGAGTTCCCGG - Intronic
1151454308 17:74216927-74216949 GTAGCAGTTTCCAGTGTGCCAGG - Intronic
1151669488 17:75564235-75564257 GGTCCAGTCTCCCCTGCTCCTGG + Intronic
1152368434 17:79870566-79870588 GGCCCAGTCTCCTGTGTCCCAGG - Intergenic
1152835760 17:82530015-82530037 GTTCCAGTTTTTTGTGTTCCTGG + Intronic
1152867711 17:82734390-82734412 AGCCCAGGTTCCAGTGATCCTGG + Intergenic
1154281304 18:13005532-13005554 AGACCAGTTTCCAGAGCTCCTGG - Intronic
1155908051 18:31476159-31476181 TGTCCCATTTCCAGTGTTCCTGG + Exonic
1156234567 18:35189493-35189515 GGTTAAGTTTCCCATGTTCCAGG + Intergenic
1157404147 18:47409579-47409601 GGTGCAGCTTCCAGTGTGCTTGG + Intergenic
1158183509 18:54744982-54745004 AGCCCACTTGCCAGTGTTCCTGG - Intronic
1159565471 18:70043007-70043029 GGTGCAGTTTCCTGTCATCCTGG - Intronic
1160518591 18:79491631-79491653 GGTCCACTTTCCAGCCTCCCCGG + Intronic
1163429415 19:17258182-17258204 AGGCCAGTTCCCAGGGTTCCAGG + Intronic
1167385033 19:49158009-49158031 GGTCCAGGTTCCAGGGTCCAGGG + Intronic
925673309 2:6334431-6334453 GATGTAATTTCCAGTGTTCCTGG - Intergenic
926614648 2:14983873-14983895 GGATGAGTTTCCAGTGCTCCTGG + Intergenic
928012993 2:27628572-27628594 GGTGCAGTCTCCAGGGTTGCTGG - Exonic
928149216 2:28810988-28811010 TCTCCAGTTTCGAGTGTGCCCGG + Intronic
931853355 2:66276059-66276081 GCTCCAATTTCCAGCTTTCCAGG + Intergenic
932671206 2:73739346-73739368 AGTCCAGGATCCAGTGATCCAGG + Intergenic
938099301 2:128487255-128487277 GGTCCTGATTCCAGGGTTACTGG + Intergenic
938945119 2:136205372-136205394 CTTCGAGTTTCCAGTGTTGCTGG + Intergenic
943015619 2:182506743-182506765 GGCCCAGTTCCCAGTTTTCTAGG - Intronic
944501490 2:200364803-200364825 GGACCAGTTGCCAGTCATCCCGG + Intronic
945612240 2:212018347-212018369 GCTCCATTTCCCAGTATTCCTGG + Intronic
945636107 2:212353042-212353064 GGGAAAGTTTCCAGTATTCCAGG - Intronic
947059298 2:226144636-226144658 GGAGCTGTTTCCAGTGTGCCAGG - Intergenic
948781107 2:240322470-240322492 GGTCCTGTCTTCAGAGTTCCCGG + Intergenic
1169079978 20:2792085-2792107 AGTCCAGTTTCCAGCCCTCCTGG + Intergenic
1171019072 20:21568693-21568715 GATTCAGTTTCCAGTTTGCCAGG - Intergenic
1171519542 20:25765341-25765363 GGTCCAGTTCCCAGGGATTCTGG + Intronic
1171557379 20:26091152-26091174 GGTCCAGTTCCCAGGGATTCTGG - Intergenic
1172483707 20:35286594-35286616 GGTCCAGTTTGCTGTGACCCAGG + Exonic
1179874631 21:44261779-44261801 GTTCAAGGTTCCAGTGGTCCGGG + Exonic
1182468785 22:30534204-30534226 GAGCCTGTGTCCAGTGTTCCTGG - Intronic
1184355871 22:43979287-43979309 GGCCCAGATTCAAGTGCTCCTGG + Intronic
1184620118 22:45671233-45671255 GCTCCAGCTTCCAGTGGACCCGG + Intergenic
950631943 3:14287696-14287718 GGCCCACTTCCCAGTGTTGCTGG + Intergenic
954390194 3:50264699-50264721 AGTCCACTTTCCAGCATTCCTGG + Intergenic
960007345 3:112793835-112793857 TGTCCAGGTTTCATTGTTCCAGG + Intronic
970296619 4:14637700-14637722 AGTCCTATTCCCAGTGTTCCAGG - Intergenic
975600662 4:76096331-76096353 GGTCCACTTTCTACTGGTCCAGG - Intronic
976358813 4:84153542-84153564 CGCCTAGTTTCCAGTGTTCTGGG + Intergenic
976432070 4:84973866-84973888 GGTCCAGTAGCCAGTGTTAAAGG - Intergenic
976499179 4:85767524-85767546 GTTCAAGTTTCCAGTGTTTATGG - Intronic
994096685 5:95853643-95853665 GGTCCTGTGTCCAGGCTTCCTGG - Intronic
995380374 5:111525017-111525039 GGTCCAGTTTCCATTTTCCTTGG - Intergenic
998142961 5:139710075-139710097 AGCCCCGTTTCCAGGGTTCCGGG + Intergenic
1000904128 5:166942629-166942651 TATCTAGTTTCCAGTGTTCTAGG - Intergenic
1003216244 6:4115617-4115639 GCACCATGTTCCAGTGTTCCTGG + Intronic
1003532835 6:6952309-6952331 GGTCCGGTTTCCTCTGATCCTGG - Intergenic
1005653109 6:27903176-27903198 GGGCCAGCCTCCAGTGTTGCAGG - Intergenic
1007432913 6:41786752-41786774 AGTCCAGTCTCCCCTGTTCCGGG - Exonic
1011090146 6:83588752-83588774 GCTCCAGTTTCTAGTGTTCTGGG + Intronic
1012279984 6:97316702-97316724 AGTCCATATTCCAGTGTTCAAGG + Intergenic
1017554607 6:155549619-155549641 GCTCCAGTTTTTAGAGTTCCTGG + Intergenic
1017792577 6:157814402-157814424 GGTACATTTTCCAGTTTTCAAGG - Intronic
1019042858 6:169120785-169120807 GATCCAGTGACCAGTGTCCCTGG - Intergenic
1020242970 7:6409814-6409836 GGGACAGTTTCCAGTGGCCCTGG + Exonic
1024974565 7:55101159-55101181 CCTCGAGTTTCCAGTCTTCCTGG - Intronic
1025280032 7:57620277-57620299 GGTCCAGTTCCCAGGGATTCTGG + Intergenic
1026341407 7:69437176-69437198 GGTTCTGTTTCAAGTGTTTCTGG + Intergenic
1026902754 7:74046136-74046158 GGCCCAGTGTCCACAGTTCCAGG + Intronic
1027430734 7:78110093-78110115 AGTACATTTTCCAGTTTTCCTGG + Intronic
1028399552 7:90409850-90409872 GGTCCAGTTATCAGTGGTCTTGG + Intronic
1029853850 7:103493253-103493275 ATTCTACTTTCCAGTGTTCCTGG - Intronic
1031440260 7:121786065-121786087 GGGCCATCTTCCAGTGATCCAGG + Intergenic
1032190981 7:129765725-129765747 TCTCCAGTTTCCATTTTTCCTGG + Intergenic
1032863916 7:135906936-135906958 CTTCCAGTTTCCAGAGTTGCTGG + Intergenic
1036206163 8:6806999-6807021 GGACCAGGTCCCAGAGTTCCGGG - Intergenic
1045148044 8:99369914-99369936 GGACTAGTTTCCAATGTTTCAGG - Intronic
1048746799 8:137623488-137623510 GATCCAGGTTCCAGTGCTCCAGG - Intergenic
1051343514 9:16132128-16132150 AGTCCAATTTCCAGGGTCCCTGG + Intergenic
1055553180 9:77450005-77450027 GGTCCAGCTTCCAGTCTGTCCGG - Intronic
1059525129 9:114984387-114984409 GGTCTGGATTCCAGTGTTGCAGG - Intergenic
1059901214 9:118928259-118928281 GGTCCCGTGGCCAGTGTTTCAGG + Intergenic
1061341358 9:129984558-129984580 GGTCCACTTTCCAGACCTCCAGG + Intronic
1186170266 X:6869362-6869384 ATTCCAGTTTCCAGTTTTTCAGG - Intergenic
1189463140 X:41258635-41258657 GGTCAAGGTTCCAGCCTTCCTGG - Intergenic
1189719051 X:43896251-43896273 GGTCCAGACTTCAGTGGTCCTGG + Intergenic
1191961080 X:66702919-66702941 GGGCCAGTTTCCAGGCTTCTGGG - Intergenic
1194322583 X:92469618-92469640 TATCCAGTTTTCAGTTTTCCAGG + Intronic
1200630738 Y:5583097-5583119 TATCCAGTTTTCAGTTTTCCAGG + Intronic