ID: 1117491153

View in Genome Browser
Species Human (GRCh38)
Location 14:56249342-56249364
Sequence ATCCACCCTCATCACATTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 136}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117491150_1117491153 3 Left 1117491150 14:56249316-56249338 CCTTTACATATATCATGCATTTG 0: 1
1: 0
2: 1
3: 24
4: 265
Right 1117491153 14:56249342-56249364 ATCCACCCTCATCACATTGTTGG 0: 1
1: 0
2: 1
3: 6
4: 136
1117491148_1117491153 21 Left 1117491148 14:56249298-56249320 CCCTCTTTCATTTAACATCCTTT 0: 1
1: 0
2: 4
3: 73
4: 642
Right 1117491153 14:56249342-56249364 ATCCACCCTCATCACATTGTTGG 0: 1
1: 0
2: 1
3: 6
4: 136
1117491149_1117491153 20 Left 1117491149 14:56249299-56249321 CCTCTTTCATTTAACATCCTTTA 0: 1
1: 0
2: 3
3: 35
4: 469
Right 1117491153 14:56249342-56249364 ATCCACCCTCATCACATTGTTGG 0: 1
1: 0
2: 1
3: 6
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117491153 Original CRISPR ATCCACCCTCATCACATTGT TGG Intronic
900905105 1:5551612-5551634 ATCCACCCTCATCTCCTGGCAGG + Intergenic
904409201 1:30314723-30314745 ATCCTCCCTCATCACCATCTGGG - Intergenic
906253768 1:44331878-44331900 ATCAACCCTGCTCACAGTGTGGG - Intronic
910090586 1:83458530-83458552 ATCCATTCTCCTCTCATTGTTGG - Intergenic
912587437 1:110779700-110779722 CCCCACCCTCAACACATTTTTGG - Intergenic
912740628 1:112191981-112192003 ATCAAAAATCATCACATTGTTGG + Intergenic
913665495 1:121044471-121044493 ATCCAACCTGATCAAATTCTTGG - Intergenic
914016891 1:143827742-143827764 ATCCAACCTGATCAAATTCTTGG - Intergenic
914160895 1:145133268-145133290 ATCCAACCTGATCAAATTCTTGG + Intergenic
914655500 1:149736281-149736303 ATCCAACCTGATCAAATTCTTGG - Intergenic
918164256 1:181929415-181929437 AAACTCCCTCATAACATTGTAGG - Intergenic
918357121 1:183715346-183715368 AACCAACCTCACCTCATTGTTGG + Intronic
922588694 1:226755804-226755826 ATCCACCTTCATCACTTAGCTGG - Intergenic
1063223928 10:3996682-3996704 ATCCACTCTCGTGACATTCTTGG + Intergenic
1064269790 10:13854374-13854396 AGCCACCCTCATCGCAGTCTTGG - Intronic
1072418444 10:95269092-95269114 ATCCTCCCTCACCACACTCTGGG + Intronic
1073867314 10:107819672-107819694 GTCCACCCTCAACACATTTCTGG - Intergenic
1079610861 11:22431237-22431259 AACCACTCTCTTCCCATTGTGGG - Intergenic
1079893819 11:26093367-26093389 ATCCCCCCTCATCACATAAGAGG + Intergenic
1085158854 11:74322556-74322578 GGCCACCCTCATCACAAAGTGGG - Intergenic
1085770172 11:79318215-79318237 ATCCCCCCTGTTCACAGTGTGGG - Intronic
1087192100 11:95265815-95265837 ATCCACCCTCCTCAGCTTCTGGG - Intergenic
1088166152 11:106939926-106939948 TTCCACCCTCACCATATTGTGGG - Exonic
1089866098 11:121633203-121633225 ATCCTCCCTCAACCCATTTTCGG - Exonic
1092367948 12:7892565-7892587 ATCCACACTCATGTCATTATTGG - Intergenic
1097324431 12:58259759-58259781 CTCCACCCCCAACACATTGAAGG + Intergenic
1100662186 12:96711490-96711512 ACCCAGCCTCACCACCTTGTGGG - Intronic
1101376643 12:104177012-104177034 ATCCACCCTCATAACTTGCTGGG - Intergenic
1103326469 12:120124658-120124680 GTCCTCCCGCATCACAGTGTTGG + Intergenic
1104264311 12:127216944-127216966 ATACACCCTCATCCCAGGGTTGG - Intergenic
1107024076 13:35781901-35781923 ATCCACCCTCCTCATTTTATTGG + Intronic
1108305461 13:49127785-49127807 AGCCTTCCTCATCACATTGATGG + Intronic
1108870768 13:54982533-54982555 ATTCACCCTCATTAGAGTGTTGG - Intergenic
1110020599 13:70464838-70464860 ATCCATACTCAGCAAATTGTTGG + Intergenic
1117491153 14:56249342-56249364 ATCCACCCTCATCACATTGTTGG + Intronic
1119880007 14:78092442-78092464 ATCCACCCTCATCTCTCTGAAGG + Intergenic
1127188722 15:56507129-56507151 AACTCCCCACATCACATTGTTGG + Intergenic
1130209583 15:81910841-81910863 ATCCACCTTCAGCTCATTCTGGG + Intergenic
1132248848 15:100318352-100318374 TTCCAACACCATCACATTGTAGG - Intronic
1136715724 16:32279603-32279625 CTCCATCCTCATCTGATTGTGGG + Intergenic
1136752187 16:32650164-32650186 CTCCATCCTCATCTGATTGTGGG - Intergenic
1136822406 16:33330298-33330320 CTCCATCCTCATCTGATTGTGGG + Intergenic
1136828969 16:33386837-33386859 CTCCATCCTCATCTGATTGTGGG + Intergenic
1136834035 16:33485619-33485641 CTCCATCCTCATCTGATTGTGGG + Intergenic
1138576774 16:57912394-57912416 GTGCACCCTCATCACAATGAGGG + Intronic
1139382107 16:66539045-66539067 ATGAACCCTCAACACAGTGTTGG + Intronic
1141782393 16:86172118-86172140 ATCCAACACCATCACATTGAGGG - Intergenic
1203010881 16_KI270728v1_random:238901-238923 CTCCATCCTCATCTGATTGTGGG - Intergenic
1203054330 16_KI270728v1_random:910148-910170 CTCCATCCTCATCTGATTGTGGG - Intergenic
1142505184 17:358710-358732 CCCCACCCTCATCACCCTGTGGG + Intronic
1142535639 17:615976-615998 CCCCACCATCATCTCATTGTGGG - Intronic
1145119863 17:20248362-20248384 CTCCATCCTCATCTCCTTGTAGG - Intronic
1145202536 17:20959462-20959484 CTCCATCCTCATCTCTTTGTAGG - Intergenic
1203172261 17_GL000205v2_random:158933-158955 ATCCACCCCCATTACAGTGAGGG + Intergenic
1203173456 17_GL000205v2_random:173817-173839 ATCCACCCCCATTACAGTGAGGG - Intergenic
1155309314 18:24508868-24508890 AGCCACCCACATCACAATGGAGG + Intergenic
1156693656 18:39739617-39739639 ATCTACCCTCAACAAATTTTAGG - Intergenic
1156811681 18:41260500-41260522 ATCCTCACTCATGAGATTGTTGG + Intergenic
1157277445 18:46321842-46321864 ATGCAGCCTGAACACATTGTTGG + Intergenic
1159358407 18:67367346-67367368 ATTCACCCTCATTAAGTTGTAGG - Intergenic
1165746330 19:38232013-38232035 CTCAACCCTCATCACATTTCTGG + Intergenic
938557234 2:132436609-132436631 ATCCATCCTCATCACAGAGATGG + Intronic
939688525 2:145228704-145228726 ATGCTGCCTCATCACATTGCCGG - Intergenic
942526728 2:176861094-176861116 ATCCATCCTCATTAGACTGTGGG - Intergenic
942693649 2:178614256-178614278 ATCCACCATCATCGCGTGGTGGG + Exonic
943317178 2:186404267-186404289 ATTCACAATCATCAAATTGTGGG - Intergenic
946263562 2:218518837-218518859 ATGCAGCATCATCACACTGTGGG - Intronic
1176328248 21:5520772-5520794 ATCCACCCCCATTACAGTGAGGG + Intergenic
1176329443 21:5535459-5535481 ATCCACCCCCATTACAGTGAGGG - Intergenic
1176398314 21:6285492-6285514 ATCCACCCCCATTACAGTGAGGG + Intergenic
1176399509 21:6300179-6300201 ATCCACCCCCATTACAGTGAGGG - Intergenic
1176437648 21:6688925-6688947 ATCCACCCCCATTACAGTGAGGG + Intergenic
1176438843 21:6703612-6703634 ATCCACCCCCATTACAGTGAGGG - Intergenic
1176461910 21:7015995-7016017 ATCCACCCCCATTACAGTGAGGG + Intergenic
1176463105 21:7030681-7030703 ATCCACCCCCATTACAGTGAGGG - Intergenic
1176485471 21:7397773-7397795 ATCCACCCCCATTACAGTGAGGG + Intergenic
1176486666 21:7412460-7412482 ATCCACCCCCATTACAGTGAGGG - Intergenic
1178839574 21:36128056-36128078 ATCCACCCTCCTCAGCCTGTTGG + Intergenic
1180702544 22:17789510-17789532 ATGCACCCTCATCACATGAGTGG + Exonic
1183496739 22:38150106-38150128 ATCCACGCTTAGCACCTTGTAGG + Intronic
1183643368 22:39106794-39106816 ATCCTCCCACCTCAAATTGTTGG - Intergenic
952839166 3:37629813-37629835 GTCCACACTCATCAGATTCTGGG + Intronic
953192317 3:40699567-40699589 ATCCGCCCTCATCACTTGGTAGG + Intergenic
954462619 3:50636217-50636239 AGCCTCCCTCATCAGACTGTGGG - Intronic
956205859 3:66754058-66754080 ATGCAGCCTCATAACATTGGAGG + Intergenic
959243699 3:103834450-103834472 ATCTACACTCATCACAATATTGG - Intergenic
962362212 3:134752043-134752065 ATCCACCCTCAACACATGCTGGG - Intronic
963447182 3:145427559-145427581 CTCCACGCTCAGCCCATTGTTGG + Intergenic
964290055 3:155168333-155168355 ATCCCTCCTCATCACAGAGTTGG - Intronic
965117849 3:164514982-164515004 CTCCCCACTCATCACACTGTGGG - Intergenic
966411610 3:179651569-179651591 GTAGACCCTCATTACATTGTTGG - Intergenic
973992632 4:56425721-56425743 TCCAACCCTCATCACATGGTCGG - Intronic
975199660 4:71571678-71571700 ATTCACTCTTTTCACATTGTAGG - Exonic
979193939 4:117897689-117897711 ATTCACTTTCATCACTTTGTTGG + Intergenic
988548974 5:32183303-32183325 TTCCAAGCTCATCACGTTGTTGG - Intergenic
989178390 5:38552893-38552915 AACCACCTTCATCACATAGTGGG - Intronic
989441589 5:41478066-41478088 TTCCACCCTCATCTCATGATAGG + Intronic
995202162 5:109438271-109438293 AGCCACTCTCATCACATCATAGG - Intergenic
996459583 5:123725732-123725754 AACCACCCCCATCCCATGGTAGG - Intergenic
996469227 5:123840470-123840492 GTCCAACCTCCTCACATTTTTGG - Intergenic
1000133874 5:158325484-158325506 AACCTACCTCATAACATTGTTGG - Intergenic
1002323539 5:178390017-178390039 ATCCGTCCTGAGCACATTGTTGG - Intronic
1009032837 6:58081192-58081214 ACCTCCCCTCATCACCTTGTTGG + Intergenic
1009208453 6:60832966-60832988 ACCTCCCCTCATCACCTTGTTGG + Intergenic
1011354266 6:86457967-86457989 CTCCACCCTCATGATCTTGTTGG + Intergenic
1011694617 6:89901017-89901039 ATCCACCCGCCTCAAAGTGTTGG + Intergenic
1012545391 6:100413254-100413276 ATCTACCCCCATCACCTTGGTGG + Intronic
1014330948 6:120062392-120062414 ATTTACCCTCATAACATTGCAGG - Intergenic
1016129522 6:140449055-140449077 ATCTACCTTCATCACATTGTTGG + Intergenic
1018359656 6:163054722-163054744 AGCCATCCTCATCCCATTTTGGG + Intronic
1022418272 7:30196986-30197008 ATCCCCCCTCAAGAAATTGTTGG + Intergenic
1024773180 7:52749772-52749794 ATCCACCCTCCTCAAAGTGTTGG + Intergenic
1025478836 7:60957755-60957777 CTCCATCCTCATCTGATTGTGGG + Intergenic
1025553219 7:62274938-62274960 CTCCATCCTCATCTGATTGTGGG - Intergenic
1027307434 7:76914993-76915015 ATCCATTCTCCTCTCATTGTTGG - Intergenic
1027775600 7:82460982-82461004 ATCAACCCTCCTCAAATTGCTGG - Intergenic
1034132321 7:148731119-148731141 TTCCACCCTCATCACCTTTGTGG - Intronic
1035556355 8:569965-569987 CTCCACCCTCATCACAGTCTGGG + Intergenic
1036138359 8:6182623-6182645 AGGCACACCCATCACATTGTTGG + Intergenic
1038755365 8:30335592-30335614 ATCCCACCCCATCACATTATGGG + Intergenic
1045795830 8:106042917-106042939 ATCCACCCTCAGAAAGTTGTTGG + Intergenic
1050163496 9:2741511-2741533 TTCCAGCCCCATCACATTGATGG + Intronic
1050781043 9:9336449-9336471 GTCCACCATCATCACCTGGTTGG - Intronic
1052914542 9:33914583-33914605 ATCCACCCGCCTCAAAATGTTGG - Intronic
1053140646 9:35680593-35680615 ATCCACCCTCATCCCTTGGCTGG + Intronic
1053196285 9:36121598-36121620 ATCCAAACACATCACACTGTGGG - Exonic
1055928320 9:81533400-81533422 ATCAACCCTAATCAAATTGAGGG + Intergenic
1062285254 9:135770014-135770036 CTCCACCCTCATCACCCTGCTGG + Exonic
1203432652 Un_GL000195v1:104867-104889 ATCCACCCCCATTACAGTGAGGG + Intergenic
1203433856 Un_GL000195v1:119697-119719 ATCCACCCCCATTACAGTGAGGG - Intergenic
1185856955 X:3544683-3544705 TTCCACCATCATCACCTTGAAGG - Intergenic
1188975181 X:36664522-36664544 ATCCACTCTTAACACTTTGTTGG + Intergenic
1189395335 X:40617543-40617565 TTCCAAGCTCATTACATTGTTGG + Intergenic
1192259444 X:69495731-69495753 TTCCTGCCTCATCACATTGGAGG - Intergenic
1192807990 X:74526623-74526645 ATCCAACCTCATTACAGTGGTGG + Intronic
1196155947 X:112430692-112430714 ATCCTCCCACATCAGATTCTGGG + Intergenic
1199971609 X:152865867-152865889 ATCCGCCCTCATGGCATTTTCGG + Exonic
1200596142 Y:5142901-5142923 ATCCACCCACATCACTTTCACGG - Intronic
1200860872 Y:7991016-7991038 TTCCACACTCTTCACATTTTTGG + Intergenic
1201050103 Y:9924136-9924158 ATTCACCCTCATTCCATGGTAGG + Intergenic
1202338775 Y:23838129-23838151 ATCCATCATTGTCACATTGTGGG + Intergenic
1202342557 Y:23885386-23885408 ATCCACCCTCAGCCAATGGTAGG - Intergenic
1202528212 Y:25784699-25784721 ATCCACCCTCAGCCAATGGTAGG + Intergenic
1202531991 Y:25831943-25831965 ATCCATCATTGTCACATTGTGGG - Intergenic