ID: 1117492652

View in Genome Browser
Species Human (GRCh38)
Location 14:56266865-56266887
Sequence TTTAATGTATAGATGCAGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 209
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 195}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117492652 Original CRISPR TTTAATGTATAGATGCAGCA TGG (reversed) Intronic
901259020 1:7857560-7857582 TAAAATGTTTTGATGCAGCATGG + Intergenic
904824847 1:33267420-33267442 CTGCATGTATAGATGGAGCAAGG - Intronic
905598795 1:39232674-39232696 TCTGATGTCTAGATGCAGCTGGG + Intronic
905770525 1:40635326-40635348 TTTTATGTATAGATGCACACAGG - Intronic
906642141 1:47447575-47447597 GTTAGTGCATAGATGCTGCAGGG - Intergenic
907007192 1:50927083-50927105 GTTAATGTTTAGAAGCAGAAAGG + Intronic
910543499 1:88388178-88388200 TTTAATTTATAGTTGCAGTAGGG - Intergenic
911026589 1:93442345-93442367 TTTATTGTGTAGATAGAGCAGGG + Intergenic
912240886 1:107906947-107906969 TTTAGTGTTTATATGAAGCATGG + Intronic
915149911 1:153822268-153822290 TGTAATGTATATATCCAGCCAGG - Intronic
917253046 1:173083394-173083416 TGTAGTGTATATATGCACCATGG + Intergenic
920737773 1:208550120-208550142 TTCATTGTATAAATGCATCATGG - Intergenic
922242301 1:223763758-223763780 TTTAATGTACGGATGCAGTAGGG - Intronic
924561886 1:245163573-245163595 GTTAATGTATACATTCAACACGG - Intronic
924885244 1:248208858-248208880 TTGGATGTTTAGATCCAGCAAGG + Intergenic
1063737336 10:8774179-8774201 TTTACTGTGTATATGAAGCAGGG + Intergenic
1065621017 10:27581220-27581242 TTTAATGTATGCATTCAGCCTGG - Intergenic
1066635450 10:37494935-37494957 TTTAAAGTATAGACCCAGCTGGG - Intergenic
1068031625 10:51711826-51711848 TTTAATAGATAGATCCAGAATGG + Intronic
1068534613 10:58228253-58228275 TTTCATGTATAAATATAGCATGG - Intronic
1069856825 10:71445668-71445690 TTTTTTGTATAGATGCAGTGGGG - Intronic
1069982082 10:72259933-72259955 TTTCCTGCATAGATGGAGCAAGG - Intergenic
1070359689 10:75675535-75675557 TTTAATTTCCAGAGGCAGCATGG + Intronic
1070461321 10:76673433-76673455 AAGATTGTATAGATGCAGCATGG + Intergenic
1071885871 10:89950527-89950549 TATAATGTATAGATGAGCCAAGG + Intergenic
1072507604 10:96084382-96084404 TTAAATGTATACATGTAGCTAGG - Intergenic
1073531140 10:104232755-104232777 TTTTTTGTAGAGATGCGGCACGG - Intergenic
1073888136 10:108065360-108065382 TTCAATGTCTAGATGCAACCAGG + Intergenic
1074229390 10:111518420-111518442 TTTCAGGTATACATTCAGCAAGG - Intergenic
1077972298 11:7207278-7207300 GTTTATGTAGAGAAGCAGCATGG + Intergenic
1078256908 11:9665879-9665901 TTTAATAAATAGATGTAGCTGGG + Intronic
1078558146 11:12347585-12347607 TTCAATTTACAGATGCAGAAGGG - Intronic
1078967068 11:16358100-16358122 TTTTATGTATACATTCTGCATGG - Intronic
1079600311 11:22304059-22304081 TTTACTGAATAGATACAGTAAGG - Intergenic
1080080301 11:28209244-28209266 TTAAATCTATAGTTACAGCAAGG + Intronic
1086306973 11:85490993-85491015 TTTTATGTATATATTCATCAGGG - Intronic
1087122808 11:94592369-94592391 GATAATGTATTGATGCAGAAAGG + Intronic
1088045491 11:105445092-105445114 ATTAATGTCTAGATACAGGAAGG + Intergenic
1088181015 11:107110869-107110891 TGTCATGTACAGCTGCAGCAGGG - Intergenic
1088615707 11:111625467-111625489 TTTAATGTTTAAATGCCTCAGGG - Intronic
1088758936 11:112911267-112911289 ATTAATGTAGAGAAGCAGGATGG - Intergenic
1090681562 11:129064565-129064587 ACTAATGTATATATTCAGCAAGG - Intronic
1091114508 11:133000551-133000573 CTTAATGTATAATTGCAGCTGGG + Intronic
1092439396 12:8484866-8484888 TTTAATGCACAGAAGCAGAATGG + Intergenic
1095200044 12:39373190-39373212 TTTAATGCAAAGATGTAGCATGG - Intronic
1095653865 12:44646486-44646508 TTTAATGTCCAAATCCAGCATGG + Intronic
1096668553 12:53183604-53183626 TTTAAATTATATATGGAGCAAGG + Intronic
1099032832 12:77549579-77549601 GTTCATGGACAGATGCAGCAGGG + Intergenic
1100038854 12:90286575-90286597 TTAAATGTAAAGATGCAGATAGG - Intergenic
1100869100 12:98892731-98892753 TTTGAAATATAGATACAGCATGG - Intronic
1101793171 12:107949236-107949258 TTTTCTGTAGTGATGCAGCAAGG - Intergenic
1106108843 13:26759864-26759886 TTTAATGTTTAAATACAGCAGGG + Intronic
1107017042 13:35715967-35715989 TGAAATGTATAGATGGACCAAGG - Intergenic
1107255855 13:38426100-38426122 TTTAATGTATGGACTCAGCATGG + Intergenic
1107797090 13:44063983-44064005 TTCAATATATAGGTGCAGTAAGG + Intergenic
1108034912 13:46280500-46280522 TTGAATGGAAAGATGCAGAAAGG - Intergenic
1109326719 13:60876761-60876783 TTTGATTTATAGAAGCTGCATGG + Intergenic
1109397578 13:61780091-61780113 TTTAAGTTACAGATGCACCAAGG + Intergenic
1111795577 13:92915107-92915129 GTTAATGCATAGAGGGAGCAGGG - Intergenic
1111947546 13:94681613-94681635 ATTAATGTATACAGGCAGCCAGG - Intergenic
1113453760 13:110432530-110432552 TTTAATGTCCAGAGGCACCATGG - Intronic
1113695206 13:112341351-112341373 TTTAATGTATACATTAGGCACGG + Intergenic
1115749818 14:36477868-36477890 TTTATTTTATAGATGGAGGAGGG - Intronic
1117138981 14:52766890-52766912 TTTAATGAAACAATGCAGCATGG - Intronic
1117311685 14:54531635-54531657 TATAAGATATAGGTGCAGCAGGG - Intronic
1117384626 14:55198737-55198759 TTTAAAGTATCGATGCAGGCAGG + Intergenic
1117492652 14:56266865-56266887 TTTAATGTATAGATGCAGCATGG - Intronic
1120331248 14:83095199-83095221 TCTCATGTCTAAATGCAGCAAGG - Intergenic
1124476297 15:30037904-30037926 TTTAATGAATAAACACAGCAAGG - Intergenic
1126643460 15:50851898-50851920 TTAAATGCATATATGCAGAAAGG - Intergenic
1127159742 15:56169763-56169785 TTTATTGCATAAATGCAGGAAGG - Intronic
1127242733 15:57136194-57136216 TTTAGTGTTTAGAAGCTGCAAGG - Intronic
1135249723 16:20890800-20890822 TTTAATGATTAGATCAAGCAGGG - Intronic
1137984085 16:53093072-53093094 ATTAAAGTGCAGATGCAGCAGGG - Intronic
1141194101 16:81846700-81846722 TTGAATCTATAGATGAAGCCAGG - Intronic
1145785546 17:27591513-27591535 TTTAATGTATACATCAACCATGG + Intronic
1147023832 17:37563432-37563454 TTAAATGTATATATTTAGCAGGG - Intronic
1148994028 17:51692651-51692673 TTCATTGTGTAGATGCACCATGG + Intronic
1152713220 17:81885329-81885351 TTTAATTTATTGTTCCAGCAGGG - Intergenic
1203198286 17_KI270729v1_random:252280-252302 TATAATGTAAAGATACAGAATGG + Intergenic
1203207890 17_KI270730v1_random:53034-53056 TATAATGTAAAGATACAGAATGG + Intergenic
1154126188 18:11694470-11694492 TTTAATTTTTAGATGGAGCATGG + Intronic
1155797339 18:30056990-30057012 TTTAATTTTTAGGCGCAGCAAGG - Intergenic
1156115042 18:33777626-33777648 TTCAAGGTATAGATTCAGCATGG - Intergenic
1156552824 18:38035879-38035901 ATTATTGCATATATGCAGCAGGG + Intergenic
1158261890 18:55615144-55615166 ATTAATCTATAGATTCAACATGG - Intronic
1158731188 18:60024346-60024368 ATGAATGTAAAGATGCAGGATGG + Intergenic
1159403124 18:67962994-67963016 TTTAATGTATGCATTCACCACGG - Intergenic
1159742553 18:72190537-72190559 TTTAATGTATAGATACAGTTGGG + Intergenic
1162134914 19:8549477-8549499 TTTAATGTATGGAGTCAGCCTGG - Intronic
1162434538 19:10649455-10649477 TTTAATGTAGAGATGGGGCTGGG + Intergenic
1167945680 19:52986701-52986723 TTGAATGCAAAGATGGAGCAAGG - Intergenic
1168421575 19:56207574-56207596 TTTAATGTAATAATTCAGCAGGG + Intronic
1168423876 19:56223300-56223322 TTTAATGTAATAATTCAGCAAGG - Intronic
925742263 2:7016424-7016446 TTTAATTTAAAAATGCAGCTGGG + Intronic
926174747 2:10580678-10580700 TTAAATATTTAGATGCACCAGGG + Intronic
926808758 2:16737857-16737879 CTTGATGTATAGATGGAGGAAGG - Intergenic
927238285 2:20898226-20898248 TCTGATGTGAAGATGCAGCAGGG + Intergenic
928389675 2:30899402-30899424 TTCACTGTCCAGATGCAGCAAGG - Intergenic
928494115 2:31814030-31814052 ATTCATATATGGATGCAGCAAGG - Intergenic
928668834 2:33579661-33579683 GTTAAGGGATAGATGGAGCAGGG - Intergenic
930008155 2:46914574-46914596 TTAAATGTATAAATGCAGCATGG - Intronic
930446383 2:51478510-51478532 TTTAATATAAAGATACAGGAAGG - Intergenic
931596036 2:63944717-63944739 TTTAATGTACAAATGGAACATGG - Intronic
931946181 2:67310458-67310480 TTTATTTTATAGATGAAGAAAGG - Intergenic
935076697 2:99752510-99752532 TTTAAGGTATAAAGGGAGCATGG - Intronic
935552599 2:104474244-104474266 TATAATGTAAAGATGTAGAATGG + Intergenic
938004368 2:127775952-127775974 TATAAGGTATAGATGGAGCCTGG - Intronic
944308338 2:198203286-198203308 TTTAATTTATAAATGAGGCATGG + Intronic
1173106219 20:40137373-40137395 TTCAATGTTTATATTCAGCATGG - Intergenic
1176357922 21:5967960-5967982 TTTAATTTATAAATTCGGCATGG - Intergenic
1177236579 21:18397523-18397545 TTTATAGTATAAATGAAGCAGGG + Intronic
1177449151 21:21243065-21243087 TAGAATGTAGAGATGAAGCAGGG + Intronic
1178679054 21:34656814-34656836 TTTAAACTATTGATGAAGCATGG + Intergenic
1179765596 21:43570591-43570613 TTTAATTTATAAATTCGGCATGG + Intronic
951562815 3:23985149-23985171 TCCATTGTATAGATGCATCATGG + Intergenic
952703375 3:36349853-36349875 TTTGATGTCTAGATCTAGCAAGG - Intergenic
953475591 3:43203213-43203235 TTTAATGCAAAGAGACAGCATGG - Intergenic
954871231 3:53769034-53769056 TTTAATGTAAAGATGCCTCCTGG + Intronic
955795665 3:62633944-62633966 TGTGTTGTATAGAGGCAGCAGGG - Intronic
956778202 3:72583970-72583992 TTTATTGTATTGATGAACCATGG - Intergenic
957822237 3:85392198-85392220 TTTAATATTGAGATGTAGCAAGG - Intronic
964577590 3:158191517-158191539 TTTTATGTAGAGATGTTGCAGGG + Intronic
964944661 3:162205715-162205737 CTTAATGTTTAGATTCACCATGG - Intergenic
966295106 3:178410846-178410868 TTTAATGTCTTTATACAGCATGG - Intergenic
966873126 3:184305057-184305079 ATTAATGGATAAATACAGCATGG + Intronic
968080868 3:195846166-195846188 ATTGTTGTATATATGCAGCATGG + Intergenic
969070248 4:4531020-4531042 TTTAATGTATGTATGAAACAAGG + Intronic
971592731 4:28489127-28489149 TCTATTGTCTGGATGCAGCATGG + Intergenic
971704826 4:30027440-30027462 TTTCATGTAGATATGAAGCAAGG + Intergenic
974469957 4:62306156-62306178 TTGTATGTATAGATACAACATGG - Intergenic
975757927 4:77589504-77589526 TTTAATGTATAAATTAGGCACGG - Intronic
977328738 4:95609836-95609858 TTTAATGAACAGCTACAGCAAGG + Intergenic
977746312 4:100551707-100551729 TTAAATCTATAGATCAAGCATGG + Intronic
981124132 4:141086163-141086185 TTTTATGTATAGAGAGAGCATGG - Intronic
981543864 4:145873960-145873982 TTTAAATAAAAGATGCAGCAAGG - Intronic
982229272 4:153193717-153193739 TTTAATTAATAAAGGCAGCATGG - Intronic
982530521 4:156536460-156536482 TGTAATGTATACATACAGGATGG + Intergenic
984291916 4:177807060-177807082 TGTAATGTTCAGAAGCAGCACGG - Intronic
985207104 4:187550408-187550430 TTTAATTTGGTGATGCAGCAGGG + Intergenic
985308236 4:188567580-188567602 TTTAATGTATAGATTCAGATGGG + Intergenic
985360588 4:189171526-189171548 TTTAAAGGATAGATGAAGAAAGG + Intergenic
986320429 5:6628031-6628053 TTTAATGTCTAGATTGAGGATGG - Intronic
986871153 5:12048526-12048548 TTTATTGTCTAGAGGCAGGAAGG - Intergenic
991502610 5:67292016-67292038 TTTAAAGAATAGATGTAGAATGG - Intergenic
994057804 5:95438932-95438954 TTATATGTATAGAGGAAGCATGG + Intronic
997032877 5:130152149-130152171 TTTCATGTGAAGATGCAGCTGGG - Intronic
997287594 5:132692660-132692682 TTGTATGTATACATGCAGCATGG - Exonic
998797748 5:145836990-145837012 TTTAAAGTATAAATCAAGCAAGG + Intergenic
998816841 5:146023079-146023101 TTTAATGTATAGATGGTTAAGGG - Intronic
999221404 5:149981560-149981582 TTCAATTTTTAGATACAGCAGGG + Exonic
999399863 5:151256302-151256324 TTTATAGAATAGTTGCAGCAGGG + Intronic
1000449262 5:161364140-161364162 TTTAATGTATATATACTGAATGG + Intronic
1002980511 6:2131709-2131731 CATAATATATAGATACAGCAAGG + Intronic
1003833526 6:10041461-10041483 TTTAATTTACAGATGCTGAAAGG - Intronic
1004781023 6:18908867-18908889 TTGAATGAATAAATGCAGTAAGG + Intergenic
1004979075 6:21002500-21002522 TGTATTGTGTATATGCAGCAAGG + Intronic
1007999980 6:46350211-46350233 TTTAATGCATGAATGGAGCAGGG + Intronic
1011774960 6:90719582-90719604 TTTAACTCATAGATGGAGCATGG - Intergenic
1013145382 6:107385203-107385225 TTTAATTTAAAAATGCAGGAAGG - Intronic
1015150138 6:130028392-130028414 TTTCATGTTTAAAGGCAGCATGG + Intronic
1016149358 6:140720161-140720183 TTTAATGTAGACATTCATCATGG + Intergenic
1016859481 6:148702562-148702584 TTTAATCTATAGATCCAGTTGGG + Intergenic
1018194158 6:161340117-161340139 ATTAATATAGAGATGTAGCAAGG + Intergenic
1020855012 7:13408686-13408708 TTTGAAGTATATATGCATCATGG + Intergenic
1022043692 7:26605139-26605161 TTTAATCTAAAGATTCAGCTGGG - Intergenic
1023926962 7:44676236-44676258 TTTAAAGTCTAGATGCACCCAGG - Intronic
1023954565 7:44873968-44873990 TTTAAACAATAGATGCAGCCAGG - Intergenic
1026773369 7:73215975-73215997 TTTAATGCATGGATGAAACAAGG - Intergenic
1027014228 7:74769371-74769393 TTTAATGCATGGATGAAACAAGG - Intergenic
1027073805 7:75176661-75176683 TTTAATGCATGGATGAAACAAGG + Intergenic
1027752461 7:82167398-82167420 TTTAGTGCACAGATACAGCAAGG - Intronic
1031204089 7:118731860-118731882 ATTAATGAATAAATGCAGAATGG - Intergenic
1032730026 7:134631599-134631621 TATATTGGATAGATGCAGCTAGG + Intergenic
1035576025 8:705918-705940 TTTAATGTTTGGATGCTGAAAGG + Intronic
1035768636 8:2128945-2128967 TTTAATGAATGGAGACAGCATGG + Intronic
1035958407 8:4109085-4109107 TTTAATGTATATAGGGAGAATGG - Intronic
1037047410 8:14325287-14325309 TTTTATGTATAGACACAGAAAGG + Intronic
1040518251 8:48152052-48152074 TTTAATGTATAAATTAGGCATGG - Intergenic
1041577481 8:59416022-59416044 TTGAATATATAAATGAAGCAGGG - Intergenic
1043679787 8:83009266-83009288 TTTATTAGATAGATGCAGCAAGG + Intergenic
1046705615 8:117447749-117447771 TTTAAAGTAAAGACCCAGCAGGG + Intergenic
1049350698 8:142163007-142163029 ATTGATGTATAGATGGAGGATGG + Intergenic
1050904912 9:10992135-10992157 TTTCATGCATGAATGCAGCAAGG - Intergenic
1051498910 9:17755942-17755964 TATCATCTATAGATTCAGCATGG + Intronic
1051797910 9:20895382-20895404 TTGAATGTATAGATGAAGTTAGG + Intronic
1052605581 9:30694903-30694925 TTTATTGTAAGGATGCAGTATGG + Intergenic
1052994226 9:34541624-34541646 GTTAATGCATAGATGAATCAAGG - Intergenic
1053542139 9:38985040-38985062 TTTATTTTAAAGATTCAGCATGG - Intergenic
1053806594 9:41808558-41808580 TTTATTTTAAAGATTCAGCATGG - Intergenic
1054624001 9:67378871-67378893 TTTATTTTAAAGATTCAGCATGG + Intergenic
1055880263 9:80992804-80992826 TTGAATATATAGATGAAGCTGGG + Intergenic
1057066100 9:92053402-92053424 TTTTATGTATATATCTAGCAGGG - Intronic
1058795233 9:108491315-108491337 TGTAATTTTTAGGTGCAGCATGG + Intergenic
1060440143 9:123631145-123631167 TATAATGAATAGATGAAGGATGG + Intronic
1186393946 X:9189093-9189115 TTGAAAATATAGCTGCAGCAAGG + Intergenic
1187329277 X:18321424-18321446 CTTAATGTATGCATGCATCAGGG - Intronic
1189891944 X:45611895-45611917 TTTAATGGATAGATGAAGTTGGG + Intergenic
1193766714 X:85537796-85537818 TTTTATGTATATATGCAGTGTGG - Intergenic
1194696483 X:97058094-97058116 TTATATGTATTGATGCAACATGG + Intronic
1194959312 X:100216696-100216718 TTTACAGTGTAAATGCAGCAGGG + Intergenic
1196053672 X:111332477-111332499 TTTAATGTATACCTGGAGCTTGG + Intronic
1196279835 X:113811475-113811497 TTTAATGTATAGATTAATCAAGG - Intergenic
1197361451 X:125508882-125508904 TTTAATTTATAAATTAAGCACGG - Intergenic
1199225434 X:145367417-145367439 TTCAAGGTATGGATGCAGAATGG + Intergenic
1201113731 Y:10819839-10819861 TTTAATGGAAAGGTGCAGAATGG - Intergenic
1201254762 Y:12096427-12096449 TTCAATGTATAAATTTAGCAGGG + Intergenic
1201734347 Y:17241682-17241704 TTAAATCAATAGATGCAGAAAGG - Intergenic
1201886094 Y:18883515-18883537 TTTAATGTATGGAAACTGCAGGG - Intergenic