ID: 1117497430

View in Genome Browser
Species Human (GRCh38)
Location 14:56319550-56319572
Sequence GATGCAGGTTAAGCCAGCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117497430_1117497435 9 Left 1117497430 14:56319550-56319572 CCACAGCTGGCTTAACCTGCATC No data
Right 1117497435 14:56319582-56319604 CCCTCAAGATGTAGCATCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117497430 Original CRISPR GATGCAGGTTAAGCCAGCTG TGG (reversed) Intergenic
No off target data available for this crispr