ID: 1117497435

View in Genome Browser
Species Human (GRCh38)
Location 14:56319582-56319604
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117497429_1117497435 13 Left 1117497429 14:56319546-56319568 CCATCCACAGCTGGCTTAACCTG No data
Right 1117497435 14:56319582-56319604 CCCTCAAGATGTAGCATCCTAGG No data
1117497431_1117497435 -6 Left 1117497431 14:56319565-56319587 CCTGCATCTTAGTCCCTCCCTCA No data
Right 1117497435 14:56319582-56319604 CCCTCAAGATGTAGCATCCTAGG No data
1117497430_1117497435 9 Left 1117497430 14:56319550-56319572 CCACAGCTGGCTTAACCTGCATC No data
Right 1117497435 14:56319582-56319604 CCCTCAAGATGTAGCATCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117497435 Original CRISPR CCCTCAAGATGTAGCATCCT AGG Intergenic