ID: 1117498332

View in Genome Browser
Species Human (GRCh38)
Location 14:56327809-56327831
Sequence TCATTCCCACACTTGGAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117498322_1117498332 23 Left 1117498322 14:56327763-56327785 CCTGGACCAATCACCAGCAAGTG No data
Right 1117498332 14:56327809-56327831 TCATTCCCACACTTGGAGCCAGG No data
1117498326_1117498332 10 Left 1117498326 14:56327776-56327798 CCAGCAAGTGGGATGAAATTACC No data
Right 1117498332 14:56327809-56327831 TCATTCCCACACTTGGAGCCAGG No data
1117498321_1117498332 28 Left 1117498321 14:56327758-56327780 CCTGTCCTGGACCAATCACCAGC No data
Right 1117498332 14:56327809-56327831 TCATTCCCACACTTGGAGCCAGG No data
1117498325_1117498332 17 Left 1117498325 14:56327769-56327791 CCAATCACCAGCAAGTGGGATGA No data
Right 1117498332 14:56327809-56327831 TCATTCCCACACTTGGAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117498332 Original CRISPR TCATTCCCACACTTGGAGCC AGG Intergenic
No off target data available for this crispr