ID: 1117501446

View in Genome Browser
Species Human (GRCh38)
Location 14:56356704-56356726
Sequence GTGTGCCTGTTCCATATTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117501446_1117501452 0 Left 1117501446 14:56356704-56356726 CCTGGAATATGGAACAGGCACAC No data
Right 1117501452 14:56356727-56356749 TGGGTGAGGTTAAAAGCGGGAGG No data
1117501446_1117501455 29 Left 1117501446 14:56356704-56356726 CCTGGAATATGGAACAGGCACAC No data
Right 1117501455 14:56356756-56356778 GAACATCACTGGAAATGAAAGGG No data
1117501446_1117501450 -4 Left 1117501446 14:56356704-56356726 CCTGGAATATGGAACAGGCACAC No data
Right 1117501450 14:56356723-56356745 ACACTGGGTGAGGTTAAAAGCGG No data
1117501446_1117501453 18 Left 1117501446 14:56356704-56356726 CCTGGAATATGGAACAGGCACAC No data
Right 1117501453 14:56356745-56356767 GGAGGAGTTAAGAACATCACTGG No data
1117501446_1117501451 -3 Left 1117501446 14:56356704-56356726 CCTGGAATATGGAACAGGCACAC No data
Right 1117501451 14:56356724-56356746 CACTGGGTGAGGTTAAAAGCGGG No data
1117501446_1117501454 28 Left 1117501446 14:56356704-56356726 CCTGGAATATGGAACAGGCACAC No data
Right 1117501454 14:56356755-56356777 AGAACATCACTGGAAATGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117501446 Original CRISPR GTGTGCCTGTTCCATATTCC AGG (reversed) Intergenic
No off target data available for this crispr