ID: 1117501453

View in Genome Browser
Species Human (GRCh38)
Location 14:56356745-56356767
Sequence GGAGGAGTTAAGAACATCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117501446_1117501453 18 Left 1117501446 14:56356704-56356726 CCTGGAATATGGAACAGGCACAC No data
Right 1117501453 14:56356745-56356767 GGAGGAGTTAAGAACATCACTGG No data
1117501445_1117501453 19 Left 1117501445 14:56356703-56356725 CCCTGGAATATGGAACAGGCACA No data
Right 1117501453 14:56356745-56356767 GGAGGAGTTAAGAACATCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117501453 Original CRISPR GGAGGAGTTAAGAACATCAC TGG Intergenic
No off target data available for this crispr