ID: 1117503039

View in Genome Browser
Species Human (GRCh38)
Location 14:56373719-56373741
Sequence TCTTATAAGAGTGTTTGGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117503039_1117503048 27 Left 1117503039 14:56373719-56373741 CCAGTCCAAACACTCTTATAAGA No data
Right 1117503048 14:56373769-56373791 CTCACCCAGTTAGGAGAAATGGG No data
1117503039_1117503043 0 Left 1117503039 14:56373719-56373741 CCAGTCCAAACACTCTTATAAGA No data
Right 1117503043 14:56373742-56373764 GGTGTCTGAAGACCACTGTTGGG No data
1117503039_1117503042 -1 Left 1117503039 14:56373719-56373741 CCAGTCCAAACACTCTTATAAGA No data
Right 1117503042 14:56373741-56373763 AGGTGTCTGAAGACCACTGTTGG No data
1117503039_1117503047 26 Left 1117503039 14:56373719-56373741 CCAGTCCAAACACTCTTATAAGA No data
Right 1117503047 14:56373768-56373790 TCTCACCCAGTTAGGAGAAATGG No data
1117503039_1117503046 18 Left 1117503039 14:56373719-56373741 CCAGTCCAAACACTCTTATAAGA No data
Right 1117503046 14:56373760-56373782 TTGGGAGGTCTCACCCAGTTAGG No data
1117503039_1117503044 3 Left 1117503039 14:56373719-56373741 CCAGTCCAAACACTCTTATAAGA No data
Right 1117503044 14:56373745-56373767 GTCTGAAGACCACTGTTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117503039 Original CRISPR TCTTATAAGAGTGTTTGGAC TGG (reversed) Intergenic