ID: 1117503041

View in Genome Browser
Species Human (GRCh38)
Location 14:56373724-56373746
Sequence ACACCTCTTATAAGAGTGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117503041_1117503053 29 Left 1117503041 14:56373724-56373746 CCAAACACTCTTATAAGAGGTGT No data
Right 1117503053 14:56373776-56373798 AGTTAGGAGAAATGGGATCGGGG No data
1117503041_1117503046 13 Left 1117503041 14:56373724-56373746 CCAAACACTCTTATAAGAGGTGT No data
Right 1117503046 14:56373760-56373782 TTGGGAGGTCTCACCCAGTTAGG 0: 6
1: 114
2: 383
3: 1093
4: 2052
1117503041_1117503052 28 Left 1117503041 14:56373724-56373746 CCAAACACTCTTATAAGAGGTGT No data
Right 1117503052 14:56373775-56373797 CAGTTAGGAGAAATGGGATCGGG No data
1117503041_1117503044 -2 Left 1117503041 14:56373724-56373746 CCAAACACTCTTATAAGAGGTGT No data
Right 1117503044 14:56373745-56373767 GTCTGAAGACCACTGTTGGGAGG No data
1117503041_1117503042 -6 Left 1117503041 14:56373724-56373746 CCAAACACTCTTATAAGAGGTGT No data
Right 1117503042 14:56373741-56373763 AGGTGTCTGAAGACCACTGTTGG No data
1117503041_1117503051 27 Left 1117503041 14:56373724-56373746 CCAAACACTCTTATAAGAGGTGT No data
Right 1117503051 14:56373774-56373796 CCAGTTAGGAGAAATGGGATCGG No data
1117503041_1117503043 -5 Left 1117503041 14:56373724-56373746 CCAAACACTCTTATAAGAGGTGT No data
Right 1117503043 14:56373742-56373764 GGTGTCTGAAGACCACTGTTGGG No data
1117503041_1117503047 21 Left 1117503041 14:56373724-56373746 CCAAACACTCTTATAAGAGGTGT No data
Right 1117503047 14:56373768-56373790 TCTCACCCAGTTAGGAGAAATGG No data
1117503041_1117503048 22 Left 1117503041 14:56373724-56373746 CCAAACACTCTTATAAGAGGTGT No data
Right 1117503048 14:56373769-56373791 CTCACCCAGTTAGGAGAAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117503041 Original CRISPR ACACCTCTTATAAGAGTGTT TGG (reversed) Intergenic
No off target data available for this crispr