ID: 1117503044

View in Genome Browser
Species Human (GRCh38)
Location 14:56373745-56373767
Sequence GTCTGAAGACCACTGTTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117503039_1117503044 3 Left 1117503039 14:56373719-56373741 CCAGTCCAAACACTCTTATAAGA No data
Right 1117503044 14:56373745-56373767 GTCTGAAGACCACTGTTGGGAGG No data
1117503041_1117503044 -2 Left 1117503041 14:56373724-56373746 CCAAACACTCTTATAAGAGGTGT No data
Right 1117503044 14:56373745-56373767 GTCTGAAGACCACTGTTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117503044 Original CRISPR GTCTGAAGACCACTGTTGGG AGG Intergenic
No off target data available for this crispr