ID: 1117503046

View in Genome Browser
Species Human (GRCh38)
Location 14:56373760-56373782
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117503041_1117503046 13 Left 1117503041 14:56373724-56373746 CCAAACACTCTTATAAGAGGTGT No data
Right 1117503046 14:56373760-56373782 TTGGGAGGTCTCACCCAGTTAGG No data
1117503039_1117503046 18 Left 1117503039 14:56373719-56373741 CCAGTCCAAACACTCTTATAAGA No data
Right 1117503046 14:56373760-56373782 TTGGGAGGTCTCACCCAGTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117503046 Original CRISPR TTGGGAGGTCTCACCCAGTT AGG Intergenic