ID: 1117503051

View in Genome Browser
Species Human (GRCh38)
Location 14:56373774-56373796
Sequence CCAGTTAGGAGAAATGGGAT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117503041_1117503051 27 Left 1117503041 14:56373724-56373746 CCAAACACTCTTATAAGAGGTGT No data
Right 1117503051 14:56373774-56373796 CCAGTTAGGAGAAATGGGATCGG No data
1117503045_1117503051 -3 Left 1117503045 14:56373754-56373776 CCACTGTTGGGAGGTCTCACCCA No data
Right 1117503051 14:56373774-56373796 CCAGTTAGGAGAAATGGGATCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117503051 Original CRISPR CCAGTTAGGAGAAATGGGAT CGG Intergenic