ID: 1117504657

View in Genome Browser
Species Human (GRCh38)
Location 14:56390078-56390100
Sequence CTACATAGACAGAAGGATCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117504657_1117504662 7 Left 1117504657 14:56390078-56390100 CCTTGATCCTTCTGTCTATGTAG No data
Right 1117504662 14:56390108-56390130 TACCTAAGGAAAGGAATAACTGG No data
1117504657_1117504663 8 Left 1117504657 14:56390078-56390100 CCTTGATCCTTCTGTCTATGTAG No data
Right 1117504663 14:56390109-56390131 ACCTAAGGAAAGGAATAACTGGG No data
1117504657_1117504661 -2 Left 1117504657 14:56390078-56390100 CCTTGATCCTTCTGTCTATGTAG No data
Right 1117504661 14:56390099-56390121 AGGCATCACTACCTAAGGAAAGG No data
1117504657_1117504660 -7 Left 1117504657 14:56390078-56390100 CCTTGATCCTTCTGTCTATGTAG No data
Right 1117504660 14:56390094-56390116 TATGTAGGCATCACTACCTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117504657 Original CRISPR CTACATAGACAGAAGGATCA AGG (reversed) Intergenic
No off target data available for this crispr