ID: 1117505802

View in Genome Browser
Species Human (GRCh38)
Location 14:56401666-56401688
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117505800_1117505802 -8 Left 1117505800 14:56401651-56401673 CCTCAGAAGGGAATAGGCTCTAC No data
Right 1117505802 14:56401666-56401688 GGCTCTACTTTGTATAGGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117505802 Original CRISPR GGCTCTACTTTGTATAGGCC AGG Intergenic
No off target data available for this crispr