ID: 1117507069

View in Genome Browser
Species Human (GRCh38)
Location 14:56414613-56414635
Sequence CAGAAAATAAAGTTGGACAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117507061_1117507069 25 Left 1117507061 14:56414565-56414587 CCAGGATACTACCCGTAGGACTG No data
Right 1117507069 14:56414613-56414635 CAGAAAATAAAGTTGGACAAGGG No data
1117507063_1117507069 14 Left 1117507063 14:56414576-56414598 CCCGTAGGACTGGATTCTGCGAG No data
Right 1117507069 14:56414613-56414635 CAGAAAATAAAGTTGGACAAGGG No data
1117507064_1117507069 13 Left 1117507064 14:56414577-56414599 CCGTAGGACTGGATTCTGCGAGT No data
Right 1117507069 14:56414613-56414635 CAGAAAATAAAGTTGGACAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117507069 Original CRISPR CAGAAAATAAAGTTGGACAA GGG Intergenic
No off target data available for this crispr