ID: 1117507214

View in Genome Browser
Species Human (GRCh38)
Location 14:56415734-56415756
Sequence TATGCTTGTAAGGATGTTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117507214_1117507218 7 Left 1117507214 14:56415734-56415756 CCAGAAACATCCTTACAAGCATA No data
Right 1117507218 14:56415764-56415786 ATAATGCTTTACCAGCTATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117507214 Original CRISPR TATGCTTGTAAGGATGTTTC TGG (reversed) Intergenic
No off target data available for this crispr