ID: 1117513164

View in Genome Browser
Species Human (GRCh38)
Location 14:56473004-56473026
Sequence CAGGCTGGATGGAAGGACTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117513159_1117513164 0 Left 1117513159 14:56472981-56473003 CCACAGTTAAATGGGTGAATGAA No data
Right 1117513164 14:56473004-56473026 CAGGCTGGATGGAAGGACTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117513164 Original CRISPR CAGGCTGGATGGAAGGACTG TGG Intergenic
No off target data available for this crispr