ID: 1117514587

View in Genome Browser
Species Human (GRCh38)
Location 14:56488180-56488202
Sequence GTCCCACTCTTTGTATCCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117514581_1117514587 -1 Left 1117514581 14:56488158-56488180 CCCAAAGGTCACCCCAGCTATGG No data
Right 1117514587 14:56488180-56488202 GTCCCACTCTTTGTATCCCCAGG No data
1117514583_1117514587 -2 Left 1117514583 14:56488159-56488181 CCAAAGGTCACCCCAGCTATGGT No data
Right 1117514587 14:56488180-56488202 GTCCCACTCTTTGTATCCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117514587 Original CRISPR GTCCCACTCTTTGTATCCCC AGG Intergenic
No off target data available for this crispr