ID: 1117520499

View in Genome Browser
Species Human (GRCh38)
Location 14:56546709-56546731
Sequence TTCATCTGATTTTGCCCCGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 95
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 88}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117520497_1117520499 -3 Left 1117520497 14:56546689-56546711 CCTGATTCTCCAGCTCTCACTTC 0: 1
1: 0
2: 2
3: 39
4: 347
Right 1117520499 14:56546709-56546731 TTCATCTGATTTTGCCCCGAAGG 0: 1
1: 0
2: 0
3: 6
4: 88

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117520499 Original CRISPR TTCATCTGATTTTGCCCCGA AGG Intronic