ID: 1117529668

View in Genome Browser
Species Human (GRCh38)
Location 14:56647629-56647651
Sequence TCCAGCAGTACTGTTTAATG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 102}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117529665_1117529668 -4 Left 1117529665 14:56647610-56647632 CCAGATATAAGTATCATGGTCCA 0: 1
1: 0
2: 0
3: 6
4: 79
Right 1117529668 14:56647629-56647651 TCCAGCAGTACTGTTTAATGGGG 0: 1
1: 0
2: 2
3: 8
4: 102
1117529664_1117529668 -3 Left 1117529664 14:56647609-56647631 CCCAGATATAAGTATCATGGTCC 0: 1
1: 0
2: 0
3: 2
4: 83
Right 1117529668 14:56647629-56647651 TCCAGCAGTACTGTTTAATGGGG 0: 1
1: 0
2: 2
3: 8
4: 102

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117529668 Original CRISPR TCCAGCAGTACTGTTTAATG GGG Exonic
903934124 1:26883164-26883186 TCAAGCAGTACTGTTGAACAGGG - Intronic
908906303 1:69015102-69015124 TCCAGTAGCACATTTTAATGAGG - Intergenic
909464561 1:75958832-75958854 TCTAGGGGTACTGTTCAATGTGG - Intergenic
910286164 1:85556486-85556508 TCTAGAAGGACTGCTTAATGAGG + Intronic
911340351 1:96628533-96628555 TCCAGAAATAATGTTTAATCTGG + Intergenic
916005455 1:160655362-160655384 TTCAGAAATACTGTTTAATCTGG - Intergenic
917374545 1:174335528-174335550 TCCACCAATACTGTTTTATGAGG + Intronic
921568470 1:216749615-216749637 TCCTGCAGTAATCTTTAATTTGG + Intronic
922128369 1:222752221-222752243 CCCAGAAGTAATGTTTAATTTGG - Intergenic
1064360648 10:14661299-14661321 TCCAGAAATAATGTTTAATCTGG - Intronic
1064611806 10:17111450-17111472 TACCGCAGCACTGTTTAATAGGG + Intronic
1065350912 10:24795029-24795051 TCTAGCATTACGGTTAAATGAGG - Intergenic
1070108815 10:73462490-73462512 TCCAGCAGCACTCTGTACTGTGG + Intronic
1075135749 10:119784511-119784533 TCCAGCAGCATCCTTTAATGTGG + Intronic
1081077484 11:38694740-38694762 TGCAGCTTTACTGTTTAAAGAGG + Intergenic
1081410879 11:42756909-42756931 TACTGCAGTACTCTTTACTGTGG - Intergenic
1083462066 11:62820461-62820483 GCCAGCAGTAATTTTTAATAAGG + Intronic
1084885050 11:72198613-72198635 TCAAGCTGCAATGTTTAATGTGG + Intergenic
1085614388 11:77984553-77984575 TGGAGGATTACTGTTTAATGGGG + Intronic
1089815373 11:121168398-121168420 TCCATCTGTACTGTTTAATGTGG + Intronic
1090732625 11:129585030-129585052 TGCAGCAGTGCTGGTTAATGAGG - Intergenic
1092797574 12:12128193-12128215 GCCAGCAGTATTGTGTAAAGAGG - Intronic
1096358446 12:50962956-50962978 ACTAGTAGTAATGTTTAATGAGG + Intronic
1098502004 12:71203566-71203588 TACAGTAATTCTGTTTAATGAGG - Intronic
1098916651 12:76263807-76263829 CCCAGAAGTAATGTTTAATCTGG - Intergenic
1100822610 12:98445443-98445465 ACCAGAAGTAATGTTTAATCTGG - Intergenic
1102747692 12:115264031-115264053 TACATCAGTACTGCTTAATATGG + Intergenic
1106403106 13:29448539-29448561 TCCAGCAGTACTGGGGACTGGGG - Intronic
1107536914 13:41344408-41344430 TAGAGCAGTACTTCTTAATGAGG + Intronic
1108107733 13:47030348-47030370 TCCAGCTGTAATGTTTATTGAGG + Intergenic
1110696859 13:78501163-78501185 TACAGCAATAGTGTGTAATGTGG - Intergenic
1114735330 14:25037746-25037768 TTCAGCAATACTTTTTAAGGTGG + Intronic
1117244562 14:53871168-53871190 TCCAGAAAGACTGTTTAATCTGG - Intergenic
1117529668 14:56647629-56647651 TCCAGCAGTACTGTTTAATGGGG + Exonic
1137555317 16:49466818-49466840 TCCAGCAGCAGTGTTTAAGCTGG + Intergenic
1139510226 16:67423858-67423880 TCCAGCAGTTCTGTTGCATAAGG - Intergenic
1143552643 17:7640543-7640565 TGGAACAGTGCTGTTTAATGGGG - Intergenic
1145290318 17:21539604-21539626 TCCTGCAGTAATGATTACTGTGG - Intronic
1146612532 17:34320409-34320431 TCCATCAGAACTTTTGAATGGGG - Intronic
1154974236 18:21441731-21441753 TCAAGGAGCACTGTTTAGTGGGG + Intronic
1155586484 18:27372145-27372167 CCTAGCAGTACTATTTAATGAGG - Intergenic
1157699760 18:49754342-49754364 TCCAGCAGTCTTTTTTATTGAGG + Intergenic
1162881071 19:13659878-13659900 TGCATCAGGAGTGTTTAATGGGG + Intergenic
1167985051 19:53307537-53307559 TTCAGCAGTTCTGCTTCATGTGG - Intergenic
926318219 2:11727166-11727188 TGCTGCAGTAGTGATTAATGGGG + Intronic
932158725 2:69441023-69441045 GCCTACAGTACTGTTTAATTAGG + Intergenic
937885838 2:126899519-126899541 TCCAGAAGTACTGTTTTATCTGG - Exonic
938585362 2:132685396-132685418 CCCAGGAGTCCTGTTGAATGGGG - Intronic
939735829 2:145843672-145843694 TCCAGAAATAGTGTTTAATCTGG - Intergenic
944057623 2:195539888-195539910 TCCAGGAATAATGTTTAATCTGG - Intergenic
944639188 2:201705555-201705577 TGGAGCAGTTCTTTTTAATGGGG - Intronic
1170693283 20:18634425-18634447 TCCAGCATTTCAATTTAATGAGG - Intronic
1175835019 20:61988111-61988133 TCCACCAGTACCGTATCATGTGG - Intronic
1178813027 21:35901391-35901413 TTCAGCAGTACAATTTTATGGGG + Intronic
1180243951 21:46533810-46533832 TCGACCTGTACTGTCTAATGTGG + Intronic
1182431495 22:30301631-30301653 TCCAGCAGGACTGTTGAAGGGGG - Intronic
952407678 3:33019166-33019188 TCCATCAGAACTGTTTTAAGTGG + Intronic
956556220 3:70526070-70526092 TCCAGAAATAATGTTTAATCTGG + Intergenic
957610901 3:82463851-82463873 TCAAGCAATAGTGTTTAATCTGG - Intergenic
959355052 3:105316021-105316043 GCCAGCAGTAGTGTTCAATCTGG - Intergenic
961102499 3:124212552-124212574 TCATGCAATACTTTTTAATGTGG - Intronic
963080074 3:141383469-141383491 CCCAGCTGTAATGTTTAATGTGG + Intronic
964222480 3:154363398-154363420 TCCAGCATTAGTGTTTGGTGAGG + Intronic
965494668 3:169383193-169383215 TGCAAAAGTATTGTTTAATGAGG + Intronic
969643123 4:8411113-8411135 ACCAGCAGTGCTGCATAATGTGG + Intronic
970135987 4:12924687-12924709 TCCAGCAGAACTATTTTATTTGG + Intergenic
970349696 4:15189622-15189644 TCCAGCAGGACTATGCAATGAGG - Intergenic
970522144 4:16896403-16896425 TCCTGCAGTTTTTTTTAATGAGG + Intronic
971626089 4:28921875-28921897 TACAGAATTACTGTTTAATATGG + Intergenic
974846359 4:67355138-67355160 CCCAGAAATAATGTTTAATGTGG + Intergenic
978775738 4:112505283-112505305 TCCAGCAGTAGTGTTTTGTCAGG + Intergenic
978947770 4:114518442-114518464 TCAAGCAATATTATTTAATGAGG + Intergenic
979782769 4:124675262-124675284 TTCACCAGTACTGCGTAATGCGG - Intronic
985993259 5:3580896-3580918 TCCAGCAGTAATGTTTAATCTGG - Intergenic
996025236 5:118638378-118638400 TCCAGCTGAACTTTGTAATGGGG + Intergenic
996845283 5:127891972-127891994 GGCAGCAGTACTGGGTAATGTGG - Intergenic
1000029461 5:157389634-157389656 TCCAGTAGTACAGTGTAGTGGGG - Intronic
1000774087 5:165395545-165395567 TCCAGCAGTTCTGTTTGACTTGG + Intergenic
1002009877 5:176270622-176270644 TCCAGCAGTGCAGTATGATGTGG + Intronic
1002216849 5:177641686-177641708 TCCAGCAGTGCAGTATGATGTGG - Intergenic
1005877065 6:30019063-30019085 ACCAGTAATTCTGTTTAATGGGG + Intergenic
1007449076 6:41929607-41929629 CCCAACAATACTGTTTAAGGAGG + Intronic
1007921320 6:45612141-45612163 TGCAGCAGCAGTGCTTAATGGGG + Intronic
1013185805 6:107757043-107757065 CCCAGCAGTATTCTCTAATGAGG - Intronic
1013327565 6:109062901-109062923 ACCAACAGTACAGTATAATGAGG - Intronic
1014815636 6:125932810-125932832 TAGAGCTGTGCTGTTTAATGTGG - Intergenic
1022796064 7:33732168-33732190 AACAGCAGTACTTCTTAATGAGG - Intergenic
1023550877 7:41368666-41368688 TCCCACAGTGCTGTTAAATGGGG + Intergenic
1023630881 7:42163215-42163237 TAGAAGAGTACTGTTTAATGTGG - Intronic
1024907401 7:54402607-54402629 TCCAGAAGTATTATTTAATTTGG - Intergenic
1025789739 7:64678260-64678282 TTTAGCAGTACTGAATAATGAGG + Intronic
1027483750 7:78732874-78732896 TCCAGCAGTCCAGTTTATGGTGG - Intronic
1029505119 7:100958930-100958952 GCCAGGAGTACTGTGTAAGGGGG - Exonic
1031056824 7:117000835-117000857 TCCAGCAATACTTCTCAATGAGG - Intronic
1031334906 7:120516109-120516131 TCAAGTAATACTGTTTAATAAGG + Intronic
1031602059 7:123722069-123722091 TGGAGCTGTACTGTTTAATAAGG + Intronic
1034505083 7:151482663-151482685 TACAGCTGTTCTGTTTATTGTGG - Intronic
1036159424 8:6372767-6372789 TGCGGCAGTACTTTTTATTGCGG - Intergenic
1039469535 8:37804686-37804708 GCCTGCAGAGCTGTTTAATGTGG - Intronic
1040022427 8:42752824-42752846 TACAGCAGAACTTTTTAGTGTGG + Exonic
1041258693 8:56001445-56001467 CCCATCACTACTGTTTCATGTGG + Intronic
1043574051 8:81636534-81636556 TCTAACTGTACTGTTTAAAGGGG + Intergenic
1048414365 8:134209889-134209911 TCCAGCATTACAGTATCATGTGG + Intergenic
1052948632 9:34189566-34189588 TCCAGCAGTGATTTTTAATTTGG - Intronic
1187378105 X:18775642-18775664 TCCAGCAGTCCTGTTTTATTGGG + Intronic
1188345570 X:29061047-29061069 TACAGCAGTGCCTTTTAATGTGG + Intronic
1192078653 X:68025609-68025631 CCCAGAAATAATGTTTAATGTGG - Intergenic
1195593479 X:106660025-106660047 TCAAGCAGGAATGTTTAATATGG + Intronic
1196178351 X:112664776-112664798 TCCAGCAGTTCTCATTAATTTGG + Intronic
1196889393 X:120277366-120277388 TGCATCTGTGCTGTTTAATGTGG + Intronic
1198813215 X:140557882-140557904 TATAGCTGTACTGTTCAATGTGG + Intergenic
1199148783 X:144404329-144404351 TACAGCAGTACTGGTGAAGGAGG - Intergenic
1201537505 Y:15067109-15067131 TCCAGGAGATCTGTTTAGTGAGG + Intergenic