ID: 1117531823

View in Genome Browser
Species Human (GRCh38)
Location 14:56667127-56667149
Sequence CTGGATACTGACCATGTTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 169}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117531823 Original CRISPR CTGGATACTGACCATGTTTC AGG (reversed) Intronic
905441452 1:37998853-37998875 CTGCATACACAGCATGTTTCTGG - Intronic
908447411 1:64213284-64213306 CTGGAGACTGACCATTTCTAAGG - Intronic
908965209 1:69753040-69753062 CTGGACGGTGGCCATGTTTCAGG + Intronic
909060388 1:70872450-70872472 CTGAACACTGACTATGTTCCAGG + Intronic
909760681 1:79282494-79282516 CTGAAAACTGAGCATGTATCAGG + Intergenic
910544755 1:88401731-88401753 CTGAACACAGAGCATGTTTCAGG - Intergenic
912883392 1:113442418-113442440 CTAGATACTGCCAATGTTTTAGG - Intronic
914393157 1:147240247-147240269 GTGGACACAGCCCATGTTTCAGG - Intronic
915118318 1:153613711-153613733 CTGGGCACTCACCATGTGTCAGG + Intergenic
915913291 1:159927475-159927497 CTGAACACTGCCCATGTTACTGG - Exonic
917719959 1:177777867-177777889 CTGGATACTCGGCATGATTCAGG + Intergenic
919977152 1:202620118-202620140 CTGTTTAGTGACCTTGTTTCTGG - Intronic
920352810 1:205348958-205348980 CTGAATAAGGACCATGCTTCTGG - Intronic
921698929 1:218245230-218245252 CTGTATCATGAGCATGTTTCTGG - Intergenic
923567071 1:235084227-235084249 CTGGTGACTGACCACGTCTCAGG - Intergenic
923672087 1:236049682-236049704 CTGAATACTCACCATATTCCAGG + Intronic
924478652 1:244405728-244405750 GTGGATACTTTCCATGTTTTGGG + Intergenic
1066700306 10:38120659-38120681 CTGAATACTGAACTTGATTCAGG + Exonic
1066991390 10:42517574-42517596 CTGAATACTGAACTTGGTTCAGG - Intergenic
1075895951 10:125994558-125994580 CTGGGTACTTACGATGTGTCAGG + Intronic
1076564361 10:131387932-131387954 CTGGATTCAAACAATGTTTCTGG + Intergenic
1080590581 11:33719957-33719979 CTTGAGACTGGCCATGTTTGAGG + Intronic
1085903655 11:80733364-80733386 GGATATACTGACCATGTTTCTGG + Intergenic
1087752092 11:102018225-102018247 CTGGATACTTACCATGTGCCAGG + Intergenic
1089198425 11:116708912-116708934 CTGGGTTTTGACCATGTGTCAGG + Intergenic
1089207860 11:116779357-116779379 TTGGATACTTACCATGGGTCAGG - Intronic
1093097445 12:14987952-14987974 CTGGATACTGACCATGGGAAAGG + Intergenic
1095821117 12:46479457-46479479 CTTGAATCTAACCATGTTTCAGG + Intergenic
1097560095 12:61192496-61192518 ATGGATACTGACAATGTCCCAGG + Intergenic
1100311214 12:93396452-93396474 AAGGAAAGTGACCATGTTTCTGG - Intronic
1101586083 12:106087250-106087272 CTGGATACGGACCAGGTAGCCGG + Intronic
1102427617 12:112856780-112856802 CTGAATAGTTACCATGTTCCGGG + Intronic
1103123422 12:118399936-118399958 CTGAATACTGATCATCTTTGGGG - Intronic
1103248494 12:119478979-119479001 CTGGACACTTACTATGTATCAGG - Intronic
1103816380 12:123660456-123660478 CTGGTTTCTGTCCATGTTTGTGG + Exonic
1106762837 13:32883897-32883919 CTGGATACTTACTATTTGTCAGG + Intergenic
1107381081 13:39857112-39857134 CAGGATTCTGACCTTGATTCAGG - Intergenic
1109451117 13:62515560-62515582 CTGGGTACTCACCATTTGTCAGG - Intergenic
1109734656 13:66466976-66466998 CTAGTTACTGACTCTGTTTCAGG + Intronic
1112854948 13:103757125-103757147 TTTGATATTGACAATGTTTCTGG + Intergenic
1113364700 13:109665329-109665351 ATGGATAATGACCACGTTTGGGG + Intergenic
1116797099 14:49403023-49403045 CTGACTTCTGACGATGTTTCTGG + Intergenic
1117453913 14:55878881-55878903 CTGGATATCTACCATGTGTCAGG - Intergenic
1117531823 14:56667127-56667149 CTGGATACTGACCATGTTTCAGG - Intronic
1118559793 14:67067043-67067065 CTGGATTCTCACCATCTTTGTGG + Intronic
1120646249 14:87078058-87078080 CAGGATAATGTCCATTTTTCAGG + Intergenic
1121333356 14:93061807-93061829 GTTGATGCTGACCATGGTTCTGG - Intronic
1124449173 15:29769823-29769845 CTTGATAATGACTATGTTACTGG + Intronic
1125930390 15:43595547-43595569 CTGTATAATGACCATGAGTCAGG - Intronic
1125943558 15:43695379-43695401 CTGTATAATGACCATGAGTCAGG - Intronic
1128146585 15:65335322-65335344 CCGGATACTGGCGATGTTTGAGG + Exonic
1128259293 15:66221316-66221338 CTGAATCCTGCCCATGCTTCCGG + Intronic
1128798386 15:70480872-70480894 CTGGATACTGAGGCTGGTTCAGG - Intergenic
1129032259 15:72627944-72627966 AAGGAGACTGACCATGTTGCTGG - Intergenic
1129217636 15:74109295-74109317 AAGGAGACTGACCATGTTGCTGG + Intronic
1129407022 15:75326682-75326704 AAGGAGACTGACCATGTTGCTGG - Intergenic
1129470228 15:75749552-75749574 AAGGAGACTGACCATGTTGCTGG - Intergenic
1129734799 15:77953590-77953612 AAGGAGACTGACCATGTTGCTGG + Intergenic
1129840792 15:78742401-78742423 AAGGAGACTGACCATGTTGCTGG - Intergenic
1129933201 15:79429267-79429289 ATGGAAACCGTCCATGTTTCTGG + Intergenic
1131022022 15:89106941-89106963 ATGGAAACAGACCATGTTTTTGG + Intronic
1133379281 16:5316391-5316413 CTGGAGACTGCCCATGTTCTGGG - Intergenic
1134913732 16:18051746-18051768 GTGGATAATGCCCAGGTTTCTGG - Intergenic
1145898564 17:28474983-28475005 CTTGTTACTGACCAGGTGTCAGG - Intronic
1146140858 17:30366852-30366874 CTGGTAACTGAACATTTTTCTGG + Intergenic
1146812364 17:35914243-35914265 CTGGATACTGAGCTTGGTCCTGG + Intergenic
1147011494 17:37452415-37452437 CTGAGTACTTACCATATTTCAGG - Intronic
1149294692 17:55251331-55251353 ATGCTTACTGAGCATGTTTCAGG - Intergenic
1151645540 17:75428421-75428443 CAGAATACTGACTATGTTTTCGG + Intergenic
1151994453 17:77599923-77599945 CTGGATCCTGACCATATTGTTGG - Intergenic
1152117764 17:78399158-78399180 CTGCATGCTGGCCATGTCTCAGG - Intronic
1158188916 18:54803465-54803487 CTGTCTACTGATCATGTTTAGGG - Intronic
1159457236 18:68675525-68675547 CTGGACACTGACGTTGTTTAGGG - Exonic
1163077187 19:14904436-14904458 TTGTATGCTGACCATGTTCCAGG + Intergenic
1164926156 19:32131615-32131637 CTGGATGCCGACCATGTGCCGGG - Intergenic
1167242045 19:48349911-48349933 CAGCATACTGATCATGTTTCAGG - Intronic
1167352075 19:48981769-48981791 CTGGACTCTGACCTTCTTTCTGG + Intronic
928015752 2:27655454-27655476 CTGGAGGCTGACCTTGCTTCTGG - Exonic
929453133 2:42049328-42049350 CTGGAAAGAGACCATGTGTCAGG + Intronic
930993012 2:57683275-57683297 CTGAACACTGAAGATGTTTCCGG - Intergenic
933195421 2:79383823-79383845 CTGGAGACTGTCCACCTTTCTGG + Intronic
933547131 2:83729060-83729082 CTGGGTCCTGATCATGTGTCTGG - Intergenic
938738509 2:134208638-134208660 TGGGATAAAGACCATGTTTCTGG - Intronic
938950470 2:136250146-136250168 GTGGAGACTGACCATGGATCAGG + Intergenic
939977018 2:148729821-148729843 CTGGATACTGCACATCTTTCAGG - Intronic
940545247 2:155075216-155075238 CTGGCTTCTCACCATATTTCTGG - Intergenic
940910078 2:159202768-159202790 GTGGGTTCTCACCATGTTTCAGG - Intronic
941299089 2:163778475-163778497 CTGGCTACTAACCATGTGCCAGG - Intergenic
942388008 2:175462195-175462217 CTGTGTACTTACCATGTGTCAGG - Intergenic
942404333 2:175637410-175637432 CTGGATACAGATCATGGTGCGGG - Intergenic
943381001 2:187147812-187147834 CTGTATATTGACCTTGTATCTGG - Intergenic
945125427 2:206504540-206504562 CTAGATGCTGGCCATGTTCCAGG + Intronic
948953195 2:241268476-241268498 CTGGCTACTGACCGTTTTGCTGG - Exonic
1171305750 20:24104487-24104509 CTGTGGGCTGACCATGTTTCAGG - Intergenic
1172684187 20:36740913-36740935 ATGGATATTTACCAGGTTTCAGG - Intronic
1172684338 20:36742503-36742525 ATGGATATTTACCAGGTTTCAGG + Intronic
1173298433 20:41779712-41779734 CTGGGCACTGCCCCTGTTTCAGG + Intergenic
1173814871 20:45980745-45980767 CTGGGTACTTACCAAGTATCAGG + Intergenic
1173832290 20:46098750-46098772 CTGGATACTGATCTTGTGTCCGG + Intergenic
1177033008 21:16006114-16006136 CTGAATACTGATCAAATTTCAGG + Intergenic
1181492672 22:23270241-23270263 CTGGATGCTGCCCATCTCTCAGG - Intronic
1182019853 22:27072372-27072394 TTGGATTCTGACCGTGTATCAGG - Intergenic
1184330328 22:43823173-43823195 CTGGCTTCTGAGCATGGTTCTGG - Intergenic
1184885222 22:47340738-47340760 CTGGATACTGACCTTGTTTGTGG - Intergenic
949320160 3:2800804-2800826 CAGGATTCTGAACATGTTTGAGG - Intronic
950398214 3:12750328-12750350 CTGGATGTTGGCCATGTTTGTGG - Intronic
954597687 3:51840789-51840811 CTGTAACCTGACCATATTTCAGG + Intergenic
955014438 3:55056048-55056070 TTGGATACTGACCCTTTTTCTGG - Intronic
955945795 3:64192250-64192272 CTGGGTGCTGGCCATGTGTCAGG + Intronic
956384357 3:68701177-68701199 CTGGCTACTGACCATCCTCCAGG + Intergenic
957040221 3:75330545-75330567 CAGGAGACTGACCAGGTTTATGG - Intergenic
957580989 3:82073057-82073079 CTGGATGCTGATAAGGTTTCTGG + Intergenic
958105530 3:89067860-89067882 CTGAATAATGACCTTGTTTGAGG + Intergenic
961033470 3:123626187-123626209 CTGGACACTCACCATGTGCCAGG + Intronic
961045015 3:123702125-123702147 CAGGAGACTGACCAGGTTTATGG - Intronic
962017586 3:131458142-131458164 ATGGGACCTGACCATGTTTCAGG - Intergenic
964591259 3:158364634-158364656 CTGAATACTTACTATGTATCAGG - Intronic
964815406 3:160712397-160712419 ATGGATACTGAGCATGATTAGGG - Intergenic
966314174 3:178626378-178626400 TTGAATACTTACCATGTGTCAGG - Intronic
969218938 4:5746803-5746825 CTGGATCCTGCCCATATTTAAGG + Intronic
969983347 4:11181235-11181257 CTGGATGCTGCCCATGTGTCAGG - Intergenic
970580243 4:17468241-17468263 CTGAATACCTACCATGTATCAGG - Intronic
972755248 4:42040087-42040109 AAGGATAGTGACCAGGTTTCTGG + Intronic
975360634 4:73466535-73466557 TTGGATACTAACCCTGTGTCAGG - Intergenic
976690180 4:87860446-87860468 CTGGATACAGATCTTTTTTCTGG + Intergenic
977727187 4:100310027-100310049 CTGAATACTTACTATGTGTCAGG - Intergenic
979315587 4:119258061-119258083 CTGAATGCTTACCATGTTCCAGG + Intronic
987917898 5:24239858-24239880 CTGGATATTGGCCATGTGTCAGG + Intergenic
989051972 5:37330446-37330468 CTGAATACCTACCATGTGTCAGG + Intronic
992247974 5:74847251-74847273 ATGGGTACAGACCATGTTTGGGG - Intronic
993016213 5:82537313-82537335 CTGAATACTGACCATGGACCAGG + Intergenic
993993129 5:94684910-94684932 CTGTATACTGATTATGTTTTGGG + Intronic
996144335 5:119955343-119955365 CTGGATATTGTCCCTGATTCTGG + Intergenic
998491376 5:142550230-142550252 CTGAATACTTACTATGTTCCAGG + Intergenic
999963127 5:156778338-156778360 CTGAACACTGACCATGTGACAGG + Intergenic
1004586651 6:17008688-17008710 CTGGATACTAGTCATGTGTCAGG - Intergenic
1005133765 6:22542733-22542755 CTGGATACTTTCTATCTTTCAGG + Intergenic
1005868900 6:29958515-29958537 CTGGGTACTGTCCCTGTTTCGGG - Intergenic
1006523069 6:34583243-34583265 CTGGATACTTACCGTGTACCAGG + Intergenic
1007365419 6:41388471-41388493 CTTGATACTGCTCATGTTTTTGG + Intergenic
1008834697 6:55811463-55811485 ATGGACACTCACCATGTGTCTGG - Intronic
1010439950 6:75882204-75882226 CTGGTGACTGACAATATTTCAGG - Intronic
1012853093 6:104470233-104470255 CTGCACACAGACCATGTTCCTGG + Intergenic
1016213210 6:141565814-141565836 CTGAGTACCTACCATGTTTCAGG + Intergenic
1016233344 6:141832469-141832491 AAGGATACTGACCATATCTCAGG + Intergenic
1016812540 6:148275082-148275104 CTGGAGCCTAACCTTGTTTCTGG - Intronic
1017229777 6:152061526-152061548 TTTGAGACAGACCATGTTTCTGG + Intronic
1018419122 6:163626803-163626825 CTGGATGCTGACCCTCTCTCAGG - Intergenic
1022234791 7:28450902-28450924 GTGGATACTCACCACATTTCAGG - Intronic
1022430920 7:30319328-30319350 CTGAATACTTACTATGTTGCAGG + Intronic
1029400762 7:100344380-100344402 CAGGATACTGATCATTTTCCAGG + Intronic
1032523077 7:132561070-132561092 CTGGATACTGACACTGGTCCTGG + Intronic
1034032616 7:147784982-147785004 CTGGATACAGACCAGTTTTGTGG + Intronic
1034318266 7:150154824-150154846 CTTGAAACTCAGCATGTTTCTGG - Intergenic
1034774487 7:153812408-153812430 CTTGAAACTCAGCATGTTTCTGG + Intergenic
1036228846 8:6982725-6982747 CTGGACAGTGGCCACGTTTCTGG - Intergenic
1036231298 8:7001835-7001857 CTGGACAGTGGCCACGTTTCTGG - Intronic
1036484706 8:9169122-9169144 CTGGACACTCAGCCTGTTTCGGG + Intergenic
1037385047 8:18330413-18330435 CATGATGCTGACCATTTTTCAGG - Intergenic
1039573281 8:38603761-38603783 CTGGATCCTGGCCATAATTCTGG + Intergenic
1039830820 8:41212584-41212606 CTGGATACGCACCTTTTTTCAGG - Intergenic
1040737163 8:50522248-50522270 CTGCTTACTGACAATGTTCCTGG - Intronic
1047994687 8:130323174-130323196 CTGGATCATCACCATGTTCCTGG + Intronic
1049127175 8:140802011-140802033 CTGGATAATGACTATGTTACTGG + Intronic
1050532256 9:6600824-6600846 CTGGGTTCTGACCAGGGTTCTGG - Intronic
1050655729 9:7826627-7826649 CTGAACACTTACCATGTATCAGG + Intronic
1051472738 9:17467229-17467251 CTGAACACTGAGCAAGTTTCTGG - Intronic
1057485373 9:95478774-95478796 CTGGTTACTAAACATGTCTCAGG + Intronic
1058324870 9:103682625-103682647 CTGGTTACTCACCATTTCTCAGG - Intergenic
1058743783 9:107969748-107969770 TTGGATTCTGACCCTCTTTCTGG - Intergenic
1058761716 9:108140442-108140464 CTGCATGCTGACCAGGTTTCTGG - Intergenic
1059662748 9:116418052-116418074 CTGTAGAGTGACCATGTTTTAGG + Intergenic
1059790359 9:117635945-117635967 TTGGAGCCTGACCATCTTTCAGG - Intergenic
1187030143 X:15478479-15478501 CTGGATTCTGACCCTGTTCCTGG - Intronic
1187246419 X:17556503-17556525 CTGGGTACTCACCATGTACCTGG + Intronic
1190421536 X:50289585-50289607 CTGGGTGCTTACCATGTGTCAGG + Intronic
1196318405 X:114257512-114257534 TTGAATACTGACAATGTTCCAGG - Intergenic
1196976650 X:121165320-121165342 CTGAATACTTACTATGTCTCAGG + Intergenic
1197352498 X:125395302-125395324 GTGGATACTGATCCTGTTTTGGG + Intergenic
1197882435 X:131181015-131181037 CTGGATATTGGTCATGTTCCAGG + Intergenic
1198418629 X:136446541-136446563 CTGAATACTTACTATGTATCAGG - Intergenic
1201491620 Y:14548167-14548189 CTGGATAATGGATATGTTTCAGG - Intronic