ID: 1117532789

View in Genome Browser
Species Human (GRCh38)
Location 14:56675578-56675600
Sequence AGGTTCCTACAGATGGTATA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 98}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117532789_1117532794 15 Left 1117532789 14:56675578-56675600 CCATATACCATCTGTAGGAACCT 0: 1
1: 0
2: 1
3: 14
4: 98
Right 1117532794 14:56675616-56675638 AGAAAAACACATGATCTCTTTGG 0: 1
1: 0
2: 1
3: 42
4: 463

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117532789 Original CRISPR AGGTTCCTACAGATGGTATA TGG (reversed) Intronic
901154919 1:7129180-7129202 AGGCTCCCACAGCTGGTATGTGG + Intronic
901434601 1:9239328-9239350 AGGTGCCTAAAGATGGGATGAGG + Intronic
904371913 1:30053265-30053287 AGTTTCCTAGACATGGTGTAGGG + Intergenic
904554900 1:31354596-31354618 ACATTCCTAAAGAGGGTATATGG + Intronic
907865972 1:58399531-58399553 AGGTTCACACAGCTGGTAAATGG + Intronic
909226786 1:73034780-73034802 AGGCTGCTGCAGGTGGTATATGG - Intergenic
911064596 1:93776938-93776960 GGGTTCTTACAGATGGAATCAGG + Intronic
911624905 1:100112640-100112662 TGGTTTCTACAAATGTTATAGGG - Intronic
911706792 1:101023765-101023787 AGGTTCTTAACTATGGTATATGG - Intronic
912221059 1:107675997-107676019 AGGATCCTACAAATGGAAAAAGG + Intronic
916141645 1:161705099-161705121 GGATTGCTGCAGATGGTATAGGG + Intergenic
918753812 1:188309885-188309907 AGGTTGCTAAAGTTGTTATAGGG - Intergenic
924562888 1:245171803-245171825 AGGTTCCCAGAGCTGGTATGCGG - Intronic
1067178707 10:43969226-43969248 AGGTTCCGACAGAGAGGATATGG - Intergenic
1067193949 10:44097695-44097717 AGTTTCCTACAGTTTGAATAGGG - Intergenic
1067927881 10:50529031-50529053 TGGTTCCTACAGCTGGAACATGG + Intronic
1070405295 10:76089226-76089248 AAGTTCCTACAGCTGGTAAATGG + Intronic
1073481412 10:103788292-103788314 AGGTTCACACAGCTGGTAAAGGG + Intronic
1080441920 11:32302402-32302424 AAGTTCCTACACCTGGTTTATGG - Intergenic
1082246121 11:49924916-49924938 TGGTTCCTACAGAAGATATAAGG + Intergenic
1083371717 11:62187670-62187692 AGGTTCTTACAGATGACAGATGG - Intergenic
1084742524 11:71148859-71148881 ACAGTCCTACAGATGGTACATGG + Intronic
1085868948 11:80326772-80326794 AGGTTGTTAAAGATGATATATGG - Intergenic
1088675205 11:112186171-112186193 AGCCTCTTACAGAGGGTATATGG + Intronic
1090735656 11:129610374-129610396 AGGTGTCAACAGATGGGATATGG + Intergenic
1092668445 12:10833773-10833795 TGGTTCCTAGAGATGTGATAGGG - Intronic
1095132182 12:38556489-38556511 AGCTTTCTAGACATGGTATAAGG - Intergenic
1096551084 12:52372027-52372049 AGGGTCAGAGAGATGGTATAGGG - Intergenic
1099338874 12:81401404-81401426 AGGTTCATACAGCTGGTAGCTGG + Intronic
1102800029 12:115724082-115724104 AGATTCTGACATATGGTATAGGG - Intergenic
1107340178 13:39397059-39397081 AGTTTCCTAGGGCTGGTATAAGG - Intronic
1107686434 13:42905008-42905030 AAATTCCTACTGATGGTATGAGG - Intronic
1109549320 13:63872675-63872697 AAATTCCTACAGATGGTATAAGG - Intergenic
1110346792 13:74458003-74458025 AGGTTCCTACATGTTGTATCAGG - Intergenic
1111799960 13:92969306-92969328 AGGATCCTAAAGATGTTTTATGG + Intergenic
1115622584 14:35154641-35154663 AGTTTCCCACAGATGGTATTTGG - Intronic
1116346320 14:43799456-43799478 AGGGTCCCACAGTTGGTAAATGG + Intergenic
1117045217 14:51806672-51806694 AGATTCTCACAGCTGGTATATGG + Intergenic
1117532789 14:56675578-56675600 AGGTTCCTACAGATGGTATATGG - Intronic
1118121580 14:62850564-62850586 AGGGGACTACAGGTGGTATAGGG + Intronic
1122255006 14:100470172-100470194 AGGTTCTTGCAGATGGAACAAGG + Intronic
1124158149 15:27246186-27246208 AGGTTCCTGGAGATCGAATATGG - Intronic
1125777425 15:42229622-42229644 AGGTTCCTTAAGATGGCATGAGG - Intronic
1125887732 15:43241082-43241104 ATGTTCCTGCAGATGGCAAATGG - Intronic
1127533210 15:59865229-59865251 AGGTTCCTCCAGAGGGTCCAGGG + Intergenic
1131202850 15:90415010-90415032 AGTTTGCTGTAGATGGTATATGG + Intronic
1133549916 16:6844164-6844186 AGATTCCTCCAGAAGCTATAAGG - Intronic
1134780264 16:16888967-16888989 AGGTTCCCAGAGATGGTGTCAGG + Intergenic
1134905171 16:17973672-17973694 AGGGTCCTAAACATGGTAGAAGG + Intergenic
1136470391 16:30475666-30475688 AAGTTCCCACAGATGGTCAAAGG + Intronic
1138409424 16:56826664-56826686 AGGAGCCTCTAGATGGTATACGG - Intronic
1142808145 17:2382370-2382392 AGGTTCCTTGAGATGGTGTTTGG - Intergenic
1144208838 17:12998026-12998048 TGGTTCCTACAGCTGGTAAGTGG - Intronic
1147331629 17:39702682-39702704 AGGTTCATACAGCAGGAATATGG - Intronic
1150241144 17:63633900-63633922 TGGTTCCTAGAGATAGTATAAGG + Intronic
1153236653 18:2994846-2994868 TGGTTTAAACAGATGGTATATGG + Intronic
1154001137 18:10483317-10483339 AGTTTCCTACAGAGGGCTTAGGG - Intronic
1157375207 18:47157445-47157467 CGGTTCTTACAGATCGAATAAGG + Exonic
1157729607 18:49992112-49992134 GTGTTCATTCAGATGGTATAGGG - Intronic
1158617154 18:58998654-58998676 AGGCTCCTACAGATGGAACAAGG - Intergenic
924996033 2:362296-362318 AGGTTCATACAGAAGATAAAGGG + Intergenic
925396130 2:3534847-3534869 AGGTTCCTCCACATGGTAGCAGG - Intronic
926531594 2:14053671-14053693 AGGTGACTACAAATGGTACAGGG + Intergenic
929010233 2:37434822-37434844 TGCTTCCTTCAGATGGTATGTGG + Intergenic
930408261 2:50990096-50990118 AGTTCCCTACAGAAGATATATGG - Intronic
935894315 2:107718088-107718110 AGCTTCCTACATATGGAATGGGG + Intergenic
936553105 2:113467760-113467782 AGGTTTTTACAGATGGAGTAGGG + Intronic
945840864 2:214886541-214886563 AGTCTCCTATAGATGGTAGATGG + Intergenic
1169897573 20:10520745-10520767 ATGTTCATACAGATGGTGTTGGG - Intronic
1173930666 20:46815412-46815434 AAGTTCCTGCAGATGTTAAATGG + Intergenic
1182748630 22:32624537-32624559 AGGTCCCTACAGGTGTTAGATGG - Intronic
1183043519 22:35201464-35201486 AGGTTCCTGCAGTTAGTAAAAGG + Intergenic
1184786141 22:46672923-46672945 AGACTCCTCCAGATGATATAGGG - Exonic
952466490 3:33592986-33593008 AGATTACTACATATGGTATATGG + Intronic
958888597 3:99757395-99757417 AGGTTCCTACAGATTTTATGGGG + Intronic
959219679 3:103500942-103500964 ATGTACCTGCAGCTGGTATATGG + Intergenic
960467972 3:118021534-118021556 TGTTTCCTACAGAAGATATATGG - Intergenic
966790574 3:183665852-183665874 AGGTTCCTACAGACAGTAGATGG - Intronic
970668037 4:18360688-18360710 AGGATCCTGCATAGGGTATATGG - Intergenic
971629493 4:28971844-28971866 AGGTCCCTCATGATGGTATAGGG + Intergenic
974409881 4:61526179-61526201 AAGTTCATACAGATGTAATAGGG + Intronic
980686194 4:136232783-136232805 AGGTTCTTACAGATGTGACAGGG + Intergenic
982996136 4:162348766-162348788 AAGGTCATACAGATGGTAAATGG + Intergenic
984194862 4:176646980-176647002 AGGTTCACACAGATGATATAGGG + Intergenic
984921497 4:184768218-184768240 AGGGTCATACAGATGGCACATGG + Intronic
993394584 5:87368548-87368570 TTGTTCTTACGGATGGTATAGGG + Intronic
997284927 5:132671053-132671075 AGGATCCTAAATATGGTCTAAGG + Intergenic
1000779277 5:165460126-165460148 AGGCTCTGACAGATGGGATAAGG + Intergenic
1001836073 5:174833780-174833802 AGTTTCCTTCAGTTGGTTTAAGG + Intergenic
1004160411 6:13207790-13207812 TGGGTCCTACAGATGGAAAATGG + Intronic
1006875861 6:37295646-37295668 AGGTTCTTACAGATCAAATAAGG + Intronic
1009869685 6:69438236-69438258 TTCTTCCTACAGATGGGATATGG + Intergenic
1014056749 6:117024862-117024884 AGATTCCTACATATGGCTTATGG - Intergenic
1014600973 6:123411698-123411720 AGATACCTGCAGATGGTAGAGGG - Intronic
1015307840 6:131730283-131730305 AGGTTTCTCCACTTGGTATAAGG - Intronic
1021301024 7:18973418-18973440 ATGTACTTATAGATGGTATATGG + Intronic
1026835681 7:73637658-73637680 AGGTTCTTACTGATGGTAGATGG + Intergenic
1028104897 7:86865620-86865642 AGTTTCCTATGGCTGGTATAAGG + Intergenic
1030958211 7:115881890-115881912 AGGCTCCTACAGATGTCAAAAGG - Intergenic
1037204671 8:16301963-16301985 AGGTTCATACAGAGGGTATGTGG - Intronic
1038632567 8:29260551-29260573 AGGTTCCTACAGATCATACAAGG + Intronic
1041243384 8:55868633-55868655 AGGTTACTACAGATGCCATCCGG + Intergenic
1045585923 8:103537268-103537290 AGGTTTCTACAAATGCTATATGG + Intronic
1053742944 9:41159719-41159741 AGGTTTTTACAGATGGAGTAGGG - Intronic
1054348221 9:63989543-63989565 AGGTTTTTACAGATGGAGTAGGG - Intergenic
1054445947 9:65315902-65315924 AGGTTTTTACAGATGGAGTAGGG - Intergenic
1054484323 9:65705608-65705630 AGGTTTTTACAGATGGAGTAGGG + Intronic
1054685399 9:68271581-68271603 AGGTTTTTACAGATGGAGTAGGG + Intronic
1055824610 9:80307992-80308014 AAGTTTCTACAGATGTTAGAGGG + Intergenic
1192148192 X:68695545-68695567 AGCTGCCTACAGATGATATCTGG + Intronic
1192797303 X:74434573-74434595 AGGTGCCTACAGATGGTTTGTGG + Intronic
1193964988 X:87974466-87974488 AGGTTGCTACAGAGGCTATCAGG - Intergenic
1200647260 Y:5800922-5800944 AGGTAGCTACAGCTGCTATAAGG - Intergenic
1201145860 Y:11065251-11065273 ACAGTCCTACAGATGGTACATGG + Intergenic