ID: 1117532869

View in Genome Browser
Species Human (GRCh38)
Location 14:56676227-56676249
Sequence GGAAACACTCAGTCATCTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 314
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 292}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117532869_1117532871 -10 Left 1117532869 14:56676227-56676249 CCTTGAGATGACTGAGTGTTTCC 0: 1
1: 0
2: 1
3: 20
4: 292
Right 1117532871 14:56676240-56676262 GAGTGTTTCCCTGGTTATTAAGG 0: 1
1: 0
2: 0
3: 5
4: 105
1117532869_1117532875 0 Left 1117532869 14:56676227-56676249 CCTTGAGATGACTGAGTGTTTCC 0: 1
1: 0
2: 1
3: 20
4: 292
Right 1117532875 14:56676250-56676272 CTGGTTATTAAGGTGGAGCTTGG 0: 1
1: 0
2: 0
3: 6
4: 108
1117532869_1117532872 -7 Left 1117532869 14:56676227-56676249 CCTTGAGATGACTGAGTGTTTCC 0: 1
1: 0
2: 1
3: 20
4: 292
Right 1117532872 14:56676243-56676265 TGTTTCCCTGGTTATTAAGGTGG 0: 1
1: 0
2: 4
3: 19
4: 233

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117532869 Original CRISPR GGAAACACTCAGTCATCTCA AGG (reversed) Intronic
903433669 1:23329448-23329470 GCAAGCACTCAGTCATCTTCAGG + Intronic
905021141 1:34813177-34813199 AGAAACACTCAGTCTTCTTAAGG - Intronic
905075565 1:35268316-35268338 GGAACAAGACAGTCATCTCAAGG - Intergenic
906275437 1:44511863-44511885 GGAAAAAATCTGTCATCTCCGGG + Intronic
908300303 1:62756004-62756026 GGAAACACTCAGGCATCAACAGG + Intergenic
908659858 1:66424272-66424294 GGAAACACTCAGGCATCAACAGG - Intergenic
910397611 1:86807948-86807970 GGAAACACTCAGGCATCAACGGG - Intergenic
911129883 1:94377074-94377096 GGAAACACTCAGGCATCAACAGG - Intergenic
911268926 1:95776938-95776960 GGAATCACTCTGTCATCTCTTGG - Intergenic
911298858 1:96149654-96149676 GGAAACACTCAGGCATCAACAGG + Intergenic
912021183 1:105110765-105110787 GGAAACACTCAGGCATCAACAGG + Intergenic
913016814 1:114745497-114745519 GAAAACACTTAGCCATCTTAAGG + Intronic
913382511 1:118227281-118227303 GGAAACACTCAGGCATCAACAGG + Intergenic
913469399 1:119174042-119174064 GGAAACACTCAGGCATCAGCAGG + Intergenic
915260453 1:154673232-154673254 GGAAACACTCAGGCATCAACAGG + Intergenic
916083514 1:161251873-161251895 GGAAACACTCAGGCATCAACAGG + Intergenic
916939412 1:169663753-169663775 GGAAACACTCAGGCATCAACAGG + Intronic
917227466 1:172800141-172800163 GGAAACACTCAGGCATCAACAGG + Intergenic
917279776 1:173369593-173369615 GGAAACACTCAGGCATCAACAGG + Intergenic
917281040 1:173378439-173378461 GGAAACACTCAGGCATCAACAGG + Intergenic
917445917 1:175105773-175105795 GGAAACACTCAGGCATCAACAGG - Intronic
918750282 1:188261987-188262009 GGAAACACTCAGGCATCAACAGG - Intergenic
918956289 1:191212403-191212425 GGAAAAAATAAGTCATTTCAGGG + Intergenic
919206182 1:194423740-194423762 GGAAACACTCAGACATCAACAGG + Intergenic
919558549 1:199092002-199092024 GGAAACACTCAGGCATCAACAGG + Intergenic
921019586 1:211223924-211223946 GGAAACACTCAGGCATCAACAGG + Intergenic
923764396 1:236879716-236879738 GTAAACATGCAGTCATCACAGGG + Intronic
1063079931 10:2757569-2757591 GAAAAGACTTAATCATCTCAGGG - Intergenic
1063321815 10:5058494-5058516 GGAAACACTCAGGCATCAACAGG - Intronic
1063414686 10:5863914-5863936 GGAAACACTCAGGCATCAACAGG + Intronic
1064603678 10:17017102-17017124 GGAAACACTCAGGCATCAACAGG - Intronic
1066614681 10:37282888-37282910 GGAAACACTCAGGCATCAACAGG - Intronic
1068240545 10:54297217-54297239 GGAAACACTCAGGCATCAATGGG + Intronic
1069137440 10:64783076-64783098 GGAAACACTCAGGCACCAAAAGG - Intergenic
1069365190 10:67688691-67688713 GGAAACACTCAGGCATCAACAGG - Intronic
1070379633 10:75869029-75869051 GGCAACATTCAGTGATTTCAGGG - Intronic
1073656829 10:105425576-105425598 GGAAACGATCAGACATTTCAGGG - Intergenic
1076041986 10:127258220-127258242 GGAAACACTCAGTGGCTTCACGG - Intronic
1078509815 11:11976932-11976954 GGAAACTCTCAGCCAGCTCAGGG + Intronic
1079309250 11:19349843-19349865 GCAGACACTCAGTCACCTCCCGG - Intergenic
1080422378 11:32121950-32121972 GGAAAAACTCAGTATTCTCCAGG - Intergenic
1081145903 11:39562431-39562453 GGAAACACTCAGGCATCAAAAGG + Intergenic
1081213923 11:40370786-40370808 GGAAACAATTTTTCATCTCATGG - Intronic
1081214989 11:40385266-40385288 GGAAACATTAAGTCATCTCAAGG + Intronic
1081421320 11:42876708-42876730 GGAAACACTCAGGCATCAACAGG + Intergenic
1081878550 11:46428267-46428289 GGTAACACTCACTCAACTCTTGG + Intronic
1082737242 11:56870410-56870432 GGAAAAACTCAGTACTCTCATGG + Intergenic
1084210893 11:67621764-67621786 GGAAACACTCAGGCATCAACAGG + Intergenic
1084518413 11:69648621-69648643 AGAAAGACACAGTCATCCCAGGG - Intronic
1084942688 11:72621515-72621537 GGTGACACACAGTCATTTCAGGG + Intronic
1086317288 11:85608221-85608243 GGAAACACTCAGGCATCAAAAGG + Intronic
1086364689 11:86096851-86096873 GGAAACAATCTGTCCCCTCAAGG - Intergenic
1087074907 11:94119913-94119935 GGAAACACTCAGGCATCAACAGG + Intergenic
1087459094 11:98423263-98423285 GGAAACACTCAGCCATCAACAGG - Intergenic
1087683432 11:101238934-101238956 GGAAACACTCAGGCATCAACAGG - Intergenic
1088492446 11:110401115-110401137 GGAAACACTCAGACATCAACAGG + Intergenic
1089798970 11:121007938-121007960 GGAGACACAAAGTCATCTTAAGG + Intergenic
1091246600 11:134101317-134101339 GGAAACACTGAATCTTTTCAAGG + Intronic
1092322320 12:7489412-7489434 GGAAACGTTAAGTCATCTAAAGG - Intronic
1092472203 12:8790003-8790025 GGAAACACTCAGGCATCAACAGG + Intergenic
1093049845 12:14492318-14492340 GGAAACGATCAGACATTTCAGGG - Intronic
1094338204 12:29384024-29384046 GGAAACACTCAGGCATCAACAGG - Intergenic
1097313921 12:58151988-58152010 AGGAACACTCAGTCATCAAATGG - Intergenic
1097623630 12:61972733-61972755 GGAAACACTAAGTCATCTGGGGG + Intronic
1097865837 12:64558629-64558651 GGGAATCCTCAGTCATTTCAAGG - Intergenic
1101704781 12:107211582-107211604 GGAAACACTCAGGCATCAACAGG + Intergenic
1102424925 12:112836178-112836200 GGAATCACTGAATGATCTCATGG - Intronic
1104001965 12:124865594-124865616 GGATACACTCACCCATCTAAGGG - Intronic
1104306089 12:127611988-127612010 GGAAACACTCAGGCATCAACAGG + Intergenic
1104609866 12:130219298-130219320 GGAAGCTTTCAGTCAACTCAGGG + Intergenic
1104767008 12:131336586-131336608 GGAAACACTCAGGCATCAACAGG + Intergenic
1105762386 13:23526573-23526595 GGAAACACTCAGGCATCAACAGG + Intergenic
1105983224 13:25540142-25540164 GGAAACACACACTCATCTTTGGG - Intronic
1106823769 13:33495014-33495036 GGAGTCACTGAGTCATGTCATGG - Intergenic
1107782695 13:43921618-43921640 AGAAAAACCCAGTCCTCTCATGG - Intergenic
1108865841 13:54921543-54921565 TGAAACACTCTTTCATCCCAGGG - Intergenic
1109092012 13:58059601-58059623 GAAAAAACCAAGTCATCTCATGG + Intergenic
1109424211 13:62150528-62150550 GGAAACACTCAGGCATCAGCAGG + Intergenic
1109500942 13:63235610-63235632 GGAAACACTCAGGCATCAACAGG + Intergenic
1110530372 13:76590467-76590489 GGAAATACCCAGACATTTCAAGG - Intergenic
1111372439 13:87335244-87335266 GGAAACACTCAGGCATCAACAGG + Intergenic
1112519018 13:100080007-100080029 GGAAACACTCAGGCATCAACAGG + Intergenic
1113204013 13:107895584-107895606 GGAAACACTCAGTCATCAACAGG - Intergenic
1113508134 13:110831138-110831160 GGAAACTGTCTGGCATCTCAGGG - Intergenic
1114207607 14:20587713-20587735 GGCAACGCTTACTCATCTCATGG - Exonic
1114758443 14:25285225-25285247 GGAAATAATCAGACATTTCAGGG - Intergenic
1115107127 14:29775150-29775172 GGAACCTCTCGGTCCTCTCAAGG - Intronic
1115285554 14:31710208-31710230 GGAAACACTCAGGCATCAACAGG - Intronic
1116158566 14:41238030-41238052 GGAAATAATCAGACATGTCAGGG - Intergenic
1116469554 14:45271069-45271091 GGAGAGACACAGTCAACTCATGG + Intergenic
1117532869 14:56676227-56676249 GGAAACACTCAGTCATCTCAAGG - Intronic
1121531843 14:94660093-94660115 ACAAAAACTCAGTCATTTCATGG + Intergenic
1122031529 14:98915934-98915956 GGAAACACTCAGTCCCTTCAGGG + Intergenic
1122080076 14:99261023-99261045 GTGAACACCCTGTCATCTCAGGG - Intronic
1122841591 14:104467150-104467172 GGAAATACTCAGACCTTTCAGGG - Intergenic
1124141638 15:27082163-27082185 GGACTCTCTCCGTCATCTCAGGG - Intronic
1126421598 15:48478868-48478890 GGAAATACTCAGTAATGACAGGG + Intronic
1131131619 15:89904054-89904076 GGAAACACTCAGCCCTCACCTGG - Intronic
1133525685 16:6603231-6603253 GGCAGAACTCAGTCATCTAAAGG + Intronic
1133610542 16:7429286-7429308 TGAAGCACTCAGGGATCTCAAGG + Intronic
1137793707 16:51196795-51196817 GGAGACACTGAGATATCTCAGGG - Intergenic
1137902332 16:52282219-52282241 GGAAACATGCAGACATCCCAAGG - Intergenic
1143123519 17:4625248-4625270 GCAAACACTCAGTCCTCTATGGG + Intergenic
1144683614 17:17211709-17211731 GCAAACACTCATTTATCCCAAGG - Intronic
1146310411 17:31764202-31764224 GGAAACACTCAGGCATCAACAGG + Intergenic
1147484206 17:40796712-40796734 GGAAACTCCCAGTGATGTCAAGG + Intronic
1148392320 17:47281425-47281447 GAAAACACTGTGTCATCTAAAGG + Intronic
1149052044 17:52317111-52317133 GCAAACACTCAAAAATCTCATGG + Intergenic
1149209571 17:54287958-54287980 GGAAACACTCAGGCATCAACAGG + Intergenic
1149500726 17:57150370-57150392 GTGATCACTCAGTCATCTAAGGG + Intergenic
1149796138 17:59521753-59521775 GCAAACTCTCAGTCATTGCATGG + Intergenic
1149953374 17:61016869-61016891 AGAAATACTCAGTAGTCTCAGGG + Intronic
1151119379 17:71775374-71775396 GGAACAACTCAGTTATTTCAAGG - Intergenic
1151567905 17:74910077-74910099 GGAAACACTCAGGCATCAACAGG + Intergenic
1156587301 18:38445435-38445457 TGACACACTCAGCCATCTCATGG - Intergenic
1157858003 18:51118774-51118796 GGAAACACTCAGGCATCAACAGG - Intergenic
1158690043 18:59652279-59652301 AGAAAAACTCAGCCAACTCATGG + Intronic
1161598331 19:5164204-5164226 GGAAACACTCAGGCATCAACAGG - Intronic
1164993051 19:32698373-32698395 GGAAACACTCAGGCATCAACAGG - Intronic
1165596817 19:37016134-37016156 GGAATCATGCAGTCATCTGACGG - Intronic
1167254967 19:48421919-48421941 GGAAGCGCTCACTCAGCTCAAGG + Exonic
925039601 2:721088-721110 GGACACACTCAGTGACCTCTGGG - Intergenic
925554564 2:5115300-5115322 GGAAACTCACAGTCATGACAGGG - Intergenic
925702257 2:6650568-6650590 GGAAACACTGAGCCATCATAAGG - Intergenic
925949997 2:8900983-8901005 GGAAACACTCAGGCATCAACAGG - Intronic
931540374 2:63323967-63323989 GGAAACACTCAGGCATCAACAGG + Intronic
932224670 2:70030199-70030221 GGAAACACTCCCCTATCTCAGGG + Intergenic
933342048 2:81036989-81037011 GGAAACACTCAGGCATCAACAGG + Intergenic
934556015 2:95287389-95287411 GGAAACACTCACTCACCTGCAGG - Exonic
934867014 2:97822821-97822843 GGAAACACTCAGGCATCAACAGG + Intronic
936262417 2:110973229-110973251 AAAAATACTCAGTCATCTGATGG - Intronic
937118901 2:119428643-119428665 GCAAACACTCTTTCATCTCGGGG - Intergenic
937594117 2:123652307-123652329 CAAAAGACACAGTCATCTCATGG + Intergenic
939851748 2:147313105-147313127 GGAAACACTCAGGCATCAACAGG + Intergenic
941537655 2:166742440-166742462 GGAAACACTCAGGCATCAACAGG - Intergenic
942213842 2:173698584-173698606 GAAAACACTCAGTCCTCTGATGG - Intergenic
943133642 2:183887158-183887180 GGAAACACTCAGGCATCAACAGG + Intergenic
944728886 2:202498635-202498657 GGAAACACTCAGGCATCAACAGG + Intronic
946207465 2:218120214-218120236 GGAAACACTCAGGCATCAACAGG - Intergenic
948002543 2:234580215-234580237 CAAAACAGTCAGTCATCACAGGG + Intergenic
1169132132 20:3171825-3171847 GGCAACAGGCTGTCATCTCAGGG - Intronic
1170255724 20:14341041-14341063 TAAAACACACAGTCATTTCATGG + Intronic
1171261402 20:23737648-23737670 GGAAACACTCAGGCATCAACAGG + Intergenic
1171505558 20:25630314-25630336 TGAAACACACAGTCATTTGATGG - Intergenic
1172340540 20:34154152-34154174 GGAAACACTCAGGCATCAACAGG + Intergenic
1173082561 20:39882811-39882833 GGTAAGACTCACTCATCTCCTGG + Intergenic
1173146874 20:40532504-40532526 GGAACTACTTAGTCAGCTCAAGG - Intergenic
1175135452 20:56820221-56820243 GGAAACAGCCTGTCACCTCATGG + Intergenic
1177570629 21:22881547-22881569 GGCAACTCTCAATCATTTCAAGG - Intergenic
1179818580 21:43923423-43923445 GGAAACATCCACGCATCTCACGG - Intronic
949449081 3:4165798-4165820 GGAAACACTCAGGCATCAACAGG - Intronic
950890313 3:16398772-16398794 CATAACACTCTGTCATCTCAAGG - Intronic
951423630 3:22517135-22517157 GGAAACGATCAGACATTTCAGGG + Intergenic
952452913 3:33448366-33448388 GGAAACACTCAGGCATCAACAGG + Intergenic
952555157 3:34522580-34522602 GGAAACACTCAGACATCAACAGG - Intergenic
952941062 3:38444728-38444750 GGAAACACTCAGGCATCAACAGG - Intergenic
953207164 3:40841288-40841310 GAAAACTGTCAGTCATCTCCTGG - Intergenic
953758371 3:45666824-45666846 GAAATGACTCTGTCATCTCAGGG + Intronic
954232379 3:49227348-49227370 GGAAACACTCAGGCATCAACAGG - Intronic
956843076 3:73157779-73157801 GGAAACACTCAGCCATCAACAGG - Intergenic
958549326 3:95593765-95593787 GGAAACACTCAGGCATCAACAGG - Intergenic
958575915 3:95949856-95949878 GGAAACACTCAGGCATCAACAGG - Intergenic
959014894 3:101122665-101122687 GTAAACACAGTGTCATCTCATGG + Intergenic
960062194 3:113334795-113334817 GGAAGCACTCAGGTATCTAAAGG + Intronic
960063575 3:113348249-113348271 GGAAACACTCAGGCATCAACAGG + Intronic
963021144 3:140874071-140874093 GGAAACACTCAGGCATCAACAGG + Intergenic
963992404 3:151669247-151669269 GGAAACACTCAGGCATCAACAGG - Intergenic
964363132 3:155919414-155919436 TGAAATAATCTGTCATCTCAGGG + Intronic
964972129 3:162576250-162576272 GGAAACACTCAGGCATCAACAGG + Intergenic
966255484 3:177912279-177912301 TGAAACACTCTCACATCTCAGGG - Intergenic
967583504 3:191187166-191187188 GGAAACACTCAGGCATCAATAGG + Intergenic
967801958 3:193671867-193671889 TGAAACACTGAGTTACCTCATGG + Intronic
968641485 4:1717146-1717168 GGAGACACAGAGTCACCTCAAGG + Exonic
970012891 4:11480020-11480042 GGAACCACTCAGATATCTTAGGG + Intergenic
971098970 4:23441134-23441156 GGAAACTCTCTGTCAAGTCAGGG - Intergenic
971578359 4:28304744-28304766 GGAAACACTCAGTCATCAACAGG + Intergenic
972885785 4:43485320-43485342 GCAAACACTCCGTCTTCACAGGG + Intergenic
973045751 4:45533183-45533205 GGAAACACTCAGGCATCAACAGG + Intergenic
974174383 4:58306087-58306109 GGAAACACTCAGGCATCAACAGG + Intergenic
974458997 4:62163877-62163899 GGAAATATTCAGACATTTCAGGG + Intergenic
974526438 4:63054579-63054601 GGAAACACTCAGGCATCAACAGG + Intergenic
974537016 4:63186361-63186383 GGAAACACTCAGGCATCAACAGG + Intergenic
975014431 4:69396020-69396042 GGAACCACTCAGGCATACCAAGG - Intronic
977311859 4:95397434-95397456 GAAAACACTCAGGCATCTAAAGG + Intronic
977626451 4:99194023-99194045 GGAAATAATCAGACATTTCAGGG - Intergenic
977835037 4:101636539-101636561 GGAAACACTCAGGCATCAACAGG - Intronic
977883976 4:102237041-102237063 GGAAACACTCAGGCATCAACAGG + Intergenic
980024447 4:127748457-127748479 GGACCCACCCAGTCATCTAATGG + Intronic
980291013 4:130847482-130847504 GGAAACACTCAGGCATCAACAGG - Intergenic
981834811 4:149042576-149042598 GGAAACAATCAGACATTTAAGGG + Intergenic
982701006 4:158659711-158659733 GGAAACACTCAGGCATCAACAGG + Intergenic
983835046 4:172375439-172375461 GGAAACACTCAGGCATCAAGAGG - Intronic
984514502 4:180721386-180721408 GGAGACACGCATTCATCTAATGG - Intergenic
984917328 4:184736178-184736200 GGAAACACTCAGGCATCAACAGG + Intergenic
985350528 4:189056688-189056710 GGAAACATTCATTCCTCTCCTGG + Intergenic
987545358 5:19305573-19305595 GGAAACACTCAGGCATCAACAGG - Intergenic
987649936 5:20727885-20727907 GGAAACAAAGAGGCATCTCAAGG - Intergenic
988188603 5:27899892-27899914 GGAAATAATCAGACAACTCATGG + Intergenic
988592138 5:32558130-32558152 GGAAACACTCAGGCATCAACAGG - Intronic
988605615 5:32676250-32676272 GGAAACACTCAGGCATCAACAGG - Intergenic
990116615 5:52399036-52399058 GGAAACACTCAGGCATCAACAGG + Intergenic
990819204 5:59818113-59818135 GGCAACACTCAGGCATGGCAGGG + Intronic
992377242 5:76200012-76200034 GGAAATAATCAGTCTTCTCAGGG + Intronic
992455077 5:76909231-76909253 GGAAACACTCAGGCATCAACAGG + Intronic
993498860 5:88640556-88640578 GAGAACACTCAGTAATCACATGG - Intergenic
994231861 5:97316531-97316553 GGAAACACTCAGGCATCAACAGG - Intergenic
995706261 5:114991809-114991831 GGAAACACTCAGGCATCAAAAGG + Intergenic
996680253 5:126223034-126223056 GGAAACACTCAGGCATCAACAGG + Intergenic
997072279 5:130635332-130635354 GGAAACACTCAGGCATCAACAGG + Intergenic
998111341 5:139505072-139505094 GGAAACACTCAGGCATCAACAGG + Intergenic
998673897 5:144385656-144385678 GGAAAGACTGAGTCAACTCTTGG + Intronic
999809369 5:155113423-155113445 GAAAATGCTCAGTGATCTCAAGG + Intergenic
999956525 5:156709251-156709273 GGAAATACTCTGTAATTTCAGGG - Intronic
1000085105 5:157881756-157881778 GGAAACACTCAGGCATCAACAGG + Intergenic
1001555533 5:172634361-172634383 GCAAACTCTCAGCCATCTGAAGG + Intergenic
1001904939 5:175463949-175463971 AGAATCAGTCAGTCATATCAAGG - Intergenic
1002451116 5:179319013-179319035 GGGAACCCTCAGTCATAACAGGG - Intronic
1003639898 6:7867968-7867990 GGAATGACTTAGGCATCTCACGG - Intronic
1003805663 6:9724038-9724060 GGAAACACTCAGGCATCAACAGG + Intronic
1006221660 6:32496762-32496784 GGAAACACTCAGGCATCAACAGG + Intergenic
1007238606 6:40409165-40409187 TGAAGCCCTCAGTCATTTCATGG + Intronic
1007957252 6:45929278-45929300 GGAATCCCTCAGGCAGCTCATGG + Intronic
1008587128 6:52960312-52960334 GGAAACACTCAGGCATCAACAGG - Intergenic
1009014566 6:57883516-57883538 GGAAACAAAGAGGCATCTCAAGG + Intergenic
1009386062 6:63085057-63085079 GGAAACACTCAGGCATCAACAGG - Intergenic
1009407830 6:63331492-63331514 GGAAACACTCAGGCATCAACAGG - Intergenic
1009470677 6:64026361-64026383 GGAAACACTCAGGCATCAACAGG + Intronic
1009872649 6:69469876-69469898 GGAAACACTCAGGCATCAACAGG + Intergenic
1013977290 6:116092829-116092851 GGAAACACTCAGTCATCAACAGG + Intergenic
1014112454 6:117634600-117634622 GAAAACACTCACTCACCTTAGGG - Intergenic
1014992269 6:128095551-128095573 GGAAATAAACAGTCATGTCATGG - Intronic
1015118605 6:129676552-129676574 GGAAAGACTCAATCTACTCATGG + Intronic
1016183897 6:141177899-141177921 GGAAACACTCAGCCATCAACAGG + Intergenic
1017227998 6:152042445-152042467 GGAAATAATCAGACATTTCAGGG - Intronic
1017332295 6:153213960-153213982 GGACACACACAGACATCTCTTGG - Intergenic
1022408622 7:30118227-30118249 AGATAGACTCAGTCATTTCAGGG - Intronic
1022804553 7:33808635-33808657 GGCAACACACAGTCAGCTCAAGG - Intergenic
1023078083 7:36503024-36503046 GGAAACACTCAGGCATCAACAGG - Intergenic
1023663902 7:42499882-42499904 GCAAACACACAATCTTCTCAAGG - Intergenic
1024534117 7:50415973-50415995 GAAAACACTCTGTCATCCTAAGG + Intergenic
1024870916 7:53961029-53961051 GGAAACACTCAGGCATCAACAGG - Intergenic
1024974300 7:55099336-55099358 AGAAAAACTCACCCATCTCATGG - Intronic
1025641407 7:63375248-63375270 GTAAACATTCTTTCATCTCAGGG + Intergenic
1026452368 7:70540483-70540505 GGAAGCACACAGTCGTCTCTGGG + Intronic
1026488749 7:70845167-70845189 GAATACACTAAGTCATTTCATGG - Intergenic
1027790993 7:82638826-82638848 GGAAACACTCAGGCATCAACAGG + Intergenic
1028495353 7:91454589-91454611 GGAAACACTCAGTCATCAACAGG - Intergenic
1031676375 7:124616965-124616987 GAAAACAATCAGACATTTCAGGG + Intergenic
1032514607 7:132497396-132497418 GTAAACACGATGTCATCTCAAGG - Intronic
1033578178 7:142706560-142706582 GCATACACTAAGTCATATCAGGG - Intergenic
1033759386 7:144423184-144423206 GGAAACACTCAGGCATCAACAGG - Intergenic
1034753989 7:153597179-153597201 GAAAACACTGAGACAGCTCAAGG - Intergenic
1036537595 8:9665614-9665636 GCATACTCTCAGTCATCTCTTGG + Intronic
1037509473 8:19567075-19567097 GCAAACACTCAGTCACCTTTAGG + Intronic
1037596068 8:20355040-20355062 GGAACCTCTCAGTGATCTCCTGG + Intergenic
1038638651 8:29306715-29306737 GGAAACACTCAGGCATCAACAGG + Intergenic
1039275878 8:35933795-35933817 GGAAACACTCAGGCATCAACAGG + Intergenic
1039693312 8:39883755-39883777 GGAAACACTCAGGCATCAACAGG - Intergenic
1039830804 8:41212374-41212396 GGAATCAGTGAGTTATCTCAAGG + Intergenic
1040965192 8:53075360-53075382 GGAAACACTCAGGCATCAACAGG - Intergenic
1041000062 8:53441124-53441146 GGAAACACTCAGGCATCAACAGG - Intergenic
1041001776 8:53461320-53461342 GGAAACACTCAGGCATCAACAGG + Intergenic
1041307678 8:56479500-56479522 GGAAGCACACAGTCTTCACATGG - Intergenic
1041986003 8:63923120-63923142 GGAAATTATCAGTCATTTCAGGG + Intergenic
1042306671 8:67340653-67340675 GCAAAATCTCAGTAATCTCATGG - Intronic
1043256926 8:78149351-78149373 GGAAACACTTAGTCATCAACGGG + Intergenic
1045423038 8:102035646-102035668 AGAAACTGTCAGTAATCTCATGG - Intronic
1046700314 8:117393104-117393126 GCAAACACTCACACATTTCAAGG + Intergenic
1048224281 8:132569750-132569772 AGAAACACCCAGACATTTCAGGG + Intergenic
1048706942 8:137164218-137164240 TGGAAGACTCAGACATCTCATGG + Intergenic
1051881963 9:21849291-21849313 GGAAATAATCAGACATTTCAGGG + Intronic
1052057911 9:23924138-23924160 GGAAACACTCAGGCATCAACAGG - Intergenic
1055458417 9:76494008-76494030 GGAAACACTCAGGCATCAACAGG - Intronic
1055940974 9:81649403-81649425 GGAAAAAGTAAATCATCTCAAGG - Intronic
1056392927 9:86155539-86155561 GGAAACACTCAGGCATCAACAGG - Intergenic
1056753204 9:89366392-89366414 GGAAACATTCTGTAAACTCAAGG + Intronic
1056797363 9:89667925-89667947 GCAAACACTCAGCCACCTCCGGG - Intergenic
1057692804 9:97301296-97301318 GGAAATAATCAGACATTTCAGGG - Intergenic
1057752805 9:97805577-97805599 GTAATCACTAAGTCATCCCAAGG - Intergenic
1058312625 9:103523857-103523879 GGAGACACACAGTCAGCTCCTGG - Intergenic
1185479104 X:433029-433051 GGACACACTCAGCAATATCAGGG - Intergenic
1187012670 X:15295899-15295921 GTTACCACTCAGTCAGCTCATGG - Intronic
1187203210 X:17155886-17155908 TGCACCTCTCAGTCATCTCAGGG - Intergenic
1188330385 X:28863739-28863761 CGAAACACTCAATCATCTGAAGG - Intronic
1190252602 X:48738364-48738386 GGAAACACCCAGATAGCTCAGGG + Intergenic
1190541315 X:51481362-51481384 GGAAACACTCAGGCATCAACAGG + Intergenic
1191206076 X:57835268-57835290 GGAAACACTCAGGCATCAACAGG - Intergenic
1191953085 X:66615708-66615730 TGAAATACTCTGTTATCTCATGG + Intronic
1192482906 X:71500458-71500480 GGAAACACTCAGGCATCAACAGG - Intronic
1192870157 X:75177017-75177039 GGAAACACTCAGGCATCAACAGG - Intergenic
1194045025 X:88991926-88991948 GGGAACACTCTCTCTTCTCATGG + Intergenic
1194992847 X:100563611-100563633 GGAAATATTCAGTAATCTGAGGG - Intergenic
1196127492 X:112115060-112115082 GGAAACACTCAGGCATCAACAGG - Intergenic
1196662090 X:118280184-118280206 GGAAACACTCAGGCATCAACAGG - Intergenic
1197398310 X:125955947-125955969 GGAAACACTATGACTTCTCAGGG - Intergenic
1199378226 X:147137465-147137487 GGAAACACTGTGTCCTCCCATGG - Intergenic
1199617092 X:149665016-149665038 GAAAACACTCAAACATTTCAAGG - Intergenic
1199625549 X:149738232-149738254 GAAAACACTCAAACATTTCAAGG + Intergenic
1199832555 X:151560480-151560502 GGAAACACTCAGGCATCAACAGG - Intergenic
1200695099 Y:6351702-6351724 GGAAACACTCAGACATCAACAGG - Intergenic
1200776088 Y:7171526-7171548 GGAAACACTCAGGCATCAACAGG + Intergenic
1200801155 Y:7388142-7388164 GGAAACACTCAGGCATCAACAGG - Intergenic
1200880931 Y:8210653-8210675 GGAAACACTCAGGCATCAACAGG - Intergenic
1201040178 Y:9823008-9823030 GGAAACACTCAGACATCAACAGG + Intergenic
1201403642 Y:13629544-13629566 GGAAACACCCAGTCATCAACAGG + Intergenic
1201487438 Y:14508056-14508078 GGAAACACTCAGGCATCAACAGG + Intergenic
1201496546 Y:14595665-14595687 GGAAACACTCAGGCATCAACAGG - Intronic
1201729721 Y:17190911-17190933 GGAAACACTCAGTCATCAACAGG - Intergenic
1201910980 Y:19133258-19133280 GGAAACACTCAGGCATCAACAGG + Intergenic
1202146820 Y:21807121-21807143 GGAAACACTCAGGCATCAACAGG - Intergenic
1202272204 Y:23083195-23083217 GGAAACACTCAGGCATCAACAGG - Intergenic
1202293822 Y:23337487-23337509 GGAAACACTCAGGCATCAACAGG + Intergenic
1202425201 Y:24716939-24716961 GGAAACACTCAGGCATCAACAGG - Intergenic
1202445588 Y:24953146-24953168 GGAAACACTCAGGCATCAACAGG + Intergenic