ID: 1117533734

View in Genome Browser
Species Human (GRCh38)
Location 14:56684693-56684715
Sequence CTCTTAGGATGGAGGAAAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 391
Summary {0: 1, 1: 0, 2: 6, 3: 35, 4: 349}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117533734 Original CRISPR CTCTTAGGATGGAGGAAAAA TGG (reversed) Intronic
900875267 1:5338071-5338093 AGCTTAGGATGGAGGAAAATGGG - Intergenic
901352100 1:8606570-8606592 TTCTTAAGATGGAAGGAAAAAGG - Intronic
902261957 1:15232527-15232549 CTCTTAGTTTGCAGGAAACATGG + Intergenic
904645931 1:31966305-31966327 CTCTGAGAATGGAGGAAAGAGGG + Intergenic
905508475 1:38499723-38499745 ATCTTAGGATGCAGGGCAAAAGG + Intergenic
905908250 1:41634008-41634030 CTCCGAGCTTGGAGGAAAAAGGG + Intronic
908880665 1:68728878-68728900 CTAGTAGAATGGAGAAAAAAAGG - Intergenic
909004625 1:70260634-70260656 CTCTTATGATGGTGAAAAAAAGG - Exonic
909008359 1:70303833-70303855 CTTTTAGGATGTATGACAAAAGG - Intronic
909169491 1:72276949-72276971 CTCCTAGGTTGAAGGAATAAAGG + Intronic
909573368 1:77143494-77143516 CTTTTATTATGGGGGAAAAATGG - Intronic
909934579 1:81536466-81536488 CTCTAAGGAGGGAGGAAATGTGG + Intronic
910036567 1:82796169-82796191 CCCTTATGATGGATGAGAAAAGG + Intergenic
910069365 1:83193184-83193206 CTCTTAGAAGGGAGGCAACATGG - Intergenic
910511775 1:88014774-88014796 CCGTAAGGATGGAGGAACAAAGG - Intergenic
911299905 1:96159135-96159157 CTATGAAAATGGAGGAAAAATGG + Intergenic
912077347 1:105891860-105891882 CTCTTAGGAAGGATGAACCAGGG + Intergenic
915040145 1:152961481-152961503 CTCTGAGGAGAGAGGAAAGAGGG + Intergenic
915646826 1:157278543-157278565 CTGTTAGGAAGGAGGAAAATCGG + Intergenic
916350464 1:163843852-163843874 CTCTAAGGATGGTGGGACAAAGG - Intergenic
917478522 1:175389564-175389586 CGCTTAGGTTTGAGGAATAATGG - Intronic
919041788 1:192398319-192398341 CTCTTAGGTTTGATGAAGAATGG + Intergenic
919677691 1:200401679-200401701 ATCTTAGAATGGAGAAGAAAAGG - Intergenic
920158921 1:203980319-203980341 CTCTTAGAAAGGGGGAATAAAGG - Intergenic
922133801 1:222805658-222805680 CTCTAGGGCTGGAGGAACAAAGG + Intergenic
1062996692 10:1872814-1872836 CTGTTAGGCTGGTGAAAAAAGGG + Intergenic
1063001653 10:1929899-1929921 CTGCTAGAATGAAGGAAAAATGG + Intergenic
1063331325 10:5162531-5162553 CTCTTAGGATGTAGCAAGTAAGG - Intergenic
1063600989 10:7481263-7481285 CTCTTAGAAAAGAGGAAATAGGG + Intergenic
1063915467 10:10877753-10877775 CTCTAAGGATGGCAGTAAAATGG - Intergenic
1066649052 10:37638553-37638575 CTCATGGGATGCAGGTAAAATGG + Intergenic
1066984330 10:42451303-42451325 CCCTTAGGAGCAAGGAAAAAGGG + Intergenic
1067031902 10:42883973-42883995 CTCATGGGATGCAGGTAAAATGG + Intergenic
1067854771 10:49782899-49782921 CTCTGAGGATGGTGGAAGGAAGG - Intergenic
1068192403 10:53668218-53668240 CTCCTAGGGGGGAGGGAAAATGG + Intergenic
1068634741 10:59336363-59336385 ATCTTAGGATGGATGAAAAGAGG + Intronic
1070260933 10:74855053-74855075 ATCTTAGCATGCAGGGAAAAAGG + Intronic
1070458749 10:76643896-76643918 CTCTGATGATTGAGGAAAACAGG - Intergenic
1070500744 10:77070539-77070561 CTATTAGGATGGACAAAGAAGGG - Intronic
1070640729 10:78167059-78167081 GTGTTCTGATGGAGGAAAAAGGG + Intergenic
1071091423 10:81923597-81923619 CTCTTAGGAGTGTGGGAAAATGG - Intronic
1072045547 10:91651103-91651125 CTCTTAGTCTGTAGGAAAAGTGG - Intergenic
1073864003 10:107780897-107780919 CTCTTGGGAGGGAAGAAAAAAGG - Intergenic
1074679161 10:115886131-115886153 CTCATAGTATGCAGGACAAATGG + Intronic
1074966146 10:118492369-118492391 TGGTCAGGATGGAGGAAAAAAGG + Intergenic
1075923314 10:126231345-126231367 ATCTTAGGAGGGAGGAAATAAGG + Intronic
1077866022 11:6222665-6222687 CTCTTAGAATCCAGGGAAAATGG - Intronic
1078360135 11:10661603-10661625 CTTTGAGGATGGAGAAAAAAGGG - Intronic
1079999806 11:27334352-27334374 CAAGTAGGATGGAGGGAAAAAGG - Intronic
1080251257 11:30236403-30236425 CTTTTAAAATGGAGTAAAAATGG + Intergenic
1081546591 11:44076137-44076159 CTCTTAGCATGGAAGGAAATTGG + Intronic
1081978625 11:47252207-47252229 CTCTTCAGATGGAAAAAAAATGG - Intronic
1083145815 11:60757626-60757648 CTTTAAGGGTGGAGGAAAAGAGG - Intronic
1083420147 11:62547723-62547745 CACCTAGGAGGGAGGATAAAAGG - Intronic
1083513937 11:63238238-63238260 CACTTAGTATGGAGCAAAAGTGG - Intronic
1084141190 11:67230725-67230747 ATCGTAGGATGGAGGGATAAGGG + Intronic
1085371311 11:76008346-76008368 TTCTTAGAATGAATGAAAAAAGG + Intronic
1086572764 11:88304432-88304454 CTTATAGGATGGTAGAAAAAAGG - Intronic
1087548202 11:99611736-99611758 CTATTAGAATGACGGAAAAAAGG - Intronic
1088215741 11:107506832-107506854 CTCTGAAGATGTAGGAGAAAAGG + Intronic
1088980644 11:114860040-114860062 CTTTGAAGATGGAGGAAGAAGGG + Intergenic
1089979071 11:122757608-122757630 GCCTTAGGAGGGAGGAAAACAGG - Intronic
1090667849 11:128926802-128926824 CTCTCAGGTTGGAGGATGAAGGG - Intergenic
1091107195 11:132933956-132933978 CTCCTGTGATGGAGAAAAAAAGG - Intronic
1092445762 12:8555630-8555652 CTCTCAGGAAGGAGACAAAAGGG + Intergenic
1092911585 12:13149928-13149950 CTCTTAGGAAGGAGAAAAGTAGG - Intergenic
1094038585 12:26098207-26098229 CTTTTAAGATGGTGGAAAAACGG + Intergenic
1095163196 12:38940983-38941005 CACTGAAGAGGGAGGAAAAACGG + Intergenic
1095277821 12:40310266-40310288 TTCTTAGGTTTAAGGAAAAAAGG + Intronic
1096003533 12:48149562-48149584 CACTTTGAATTGAGGAAAAATGG - Exonic
1096342396 12:50812375-50812397 ATCTCAGGATGGCGGTAAAAGGG + Intronic
1096930339 12:55200944-55200966 CTCTTAGGATGAAGCTGAAAAGG - Intergenic
1100024323 12:90109219-90109241 CACTGAGGATGGAGAAAATAGGG - Intergenic
1100532963 12:95477603-95477625 CTCTTTTGGCGGAGGAAAAATGG + Intronic
1102539551 12:113608814-113608836 CTCCCAGTATGGAGGAAAGAAGG + Intergenic
1104426316 12:128681313-128681335 CTCTCAGGAAGGAGGACAAGAGG - Intronic
1106920171 13:34554698-34554720 CTATTTTGATAGAGGAAAAATGG - Intergenic
1107474633 13:40723598-40723620 CTCAAAAGATGCAGGAAAAAAGG - Intergenic
1107858535 13:44638834-44638856 CTATTAGTAAGGAGGAAGAAGGG + Intergenic
1108588634 13:51892806-51892828 CTGCTAGGACGGAGGAACAAAGG - Intergenic
1108738668 13:53312098-53312120 CTCAAAGGATTGAGGAAGAATGG - Intergenic
1109916593 13:68995242-68995264 TTCTTAAGATGGAAGGAAAAAGG - Intergenic
1110441986 13:75536540-75536562 CTTATAAGAGGGAGGAAAAAGGG + Intronic
1111704130 13:91726800-91726822 CTGTGCAGATGGAGGAAAAAGGG - Intronic
1112193420 13:97200343-97200365 CACTCAGGATGCAGGAAAGATGG + Intergenic
1114441363 14:22750976-22750998 CTCCTAGGCTGGAGGGACAATGG + Intergenic
1114745830 14:25145921-25145943 CCCTCAGGGTGGAGGAAAAGGGG + Intergenic
1115259169 14:31435783-31435805 CTCTCAGGTAGGAGGAAAGATGG - Intronic
1115709892 14:36039321-36039343 CTCTTGGGGTGGAGGACAAGTGG - Intergenic
1117025109 14:51611145-51611167 CTCTTTGGAGAGGGGAAAAATGG + Intronic
1117533734 14:56684693-56684715 CTCTTAGGATGGAGGAAAAATGG - Intronic
1117658447 14:57980320-57980342 GTGTTAGGATGGAGGCAAATGGG + Intronic
1119053769 14:71397242-71397264 ATGTCATGATGGAGGAAAAATGG - Intronic
1120486880 14:85125266-85125288 CTGTCAGGATGAAGAAAAAAAGG - Intergenic
1121411997 14:93754591-93754613 ATCATAGGAGGGAGGGAAAAGGG + Intronic
1121821269 14:96969318-96969340 CTGTTAGGATGTAGAGAAAAGGG + Intergenic
1121881623 14:97506160-97506182 CTCTGAGAATGGATGAAATAAGG + Intergenic
1121898887 14:97674272-97674294 TTCTAAGGAAGAAGGAAAAAGGG + Intergenic
1122139760 14:99655810-99655832 CTCTTGGGTTGGAGGAACAAAGG + Intronic
1123671447 15:22663460-22663482 CTCATAGGATGAGGAAAAAATGG + Intergenic
1124527374 15:30469870-30469892 CTCATAGGATGAGGAAAAAATGG + Intergenic
1124771279 15:32537813-32537835 CTCATAGGATGAGGAAAAAATGG - Intergenic
1125035159 15:35115292-35115314 CTCTCAGGCTGGGGGATAAATGG - Intergenic
1126096718 15:45095484-45095506 CTTTGAGGATGGAGGCAAAGGGG + Exonic
1126108494 15:45162308-45162330 CTTTGAGGATGGAGGCAAAAGGG - Exonic
1127417650 15:58772266-58772288 CTTTTGGGGTGGAGGAAAACGGG + Intronic
1128219683 15:65959455-65959477 CTGTTTTGATGGAGGAAAAGTGG - Intronic
1128640970 15:69337054-69337076 CTATTGGAATAGAGGAAAAAAGG + Intronic
1129043364 15:72710161-72710183 ATCTTTGGATAGATGAAAAATGG + Intronic
1129117050 15:73370105-73370127 CTCACAGGAGGGAGGCAAAAAGG + Intergenic
1129679311 15:77649076-77649098 CTCTTAGCTTGGAGGATTAAGGG - Intronic
1130207032 15:81886593-81886615 CTCCTAGCATGAAGGTAAAATGG + Intergenic
1130213393 15:81946522-81946544 CCCTTAGGAGGCAGGAAAATAGG + Intergenic
1132082727 15:98881198-98881220 CTCTTAGTGTGGCGGAGAAAAGG + Intronic
1133107603 16:3523271-3523293 ATCATAGGATGGAGCAAGAAAGG + Exonic
1133851406 16:9507683-9507705 CTCTTGGGATGCAGGAGCAAAGG - Intergenic
1134360953 16:13530690-13530712 CTGTAAGGAAGGAAGAAAAAGGG - Intergenic
1138054857 16:53822055-53822077 CCCTCAGGATGGATGAAACATGG - Intronic
1138707476 16:58931708-58931730 ACCTTAGGATGGAGGAAGAGTGG + Intergenic
1139273499 16:65705311-65705333 GTCTCAGAATGGAGGAAATATGG - Intergenic
1140335295 16:74099164-74099186 CCCTTACGATGGATGAGAAAAGG + Intergenic
1144174886 17:12695551-12695573 CTCTTAGAATGTAGCACAAAGGG - Intronic
1144469486 17:15524792-15524814 ATCTTAGGATGAAGGCATAAAGG - Intronic
1144926869 17:18818885-18818907 ATCTTAGGATGAAGGCATAAAGG + Intergenic
1145275169 17:21424832-21424854 CTCTGTGGCTGGAGGAGAAAGGG + Intergenic
1145313023 17:21710730-21710752 CTCTGTGGCTGGAGGAGAAAGGG + Intergenic
1145842883 17:28010962-28010984 CAATTATGATGGAAGAAAAAGGG - Intergenic
1147817482 17:43220733-43220755 TTCTCAGCATGGAGGAAGAAAGG + Intergenic
1148468289 17:47877892-47877914 GTCTTAGGAGGGAGGGAAGAGGG - Intergenic
1148552435 17:48558537-48558559 CTCTGAGAATGGAAGAAAAAAGG - Intronic
1150640970 17:66949170-66949192 CACTTACGATAGAGGCAAAAAGG - Intergenic
1151065708 17:71147452-71147474 CTTTTAAAAAGGAGGAAAAATGG - Intergenic
1153347180 18:4039440-4039462 CTCTTAGGAAAGAGAAAAAGAGG - Intronic
1155367789 18:25066153-25066175 CTGTTGGGCTGGAGCAAAAAAGG - Intronic
1155421179 18:25658286-25658308 CTATGAGGATTGAGGAAAAAGGG - Intergenic
1155860839 18:30897359-30897381 CTCTGAGTTTGGTGGAAAAAAGG + Intergenic
1157636963 18:49168169-49168191 CTCTGAGGAAGGAGGAAAAAGGG + Intronic
1158717349 18:59892465-59892487 CTATTAGGAAGCAAGAAAAATGG + Intergenic
1159542885 18:69802030-69802052 TGCATAGGATGGAGGAAAAAGGG - Intronic
1160847938 19:1174539-1174561 TTCTGAGGAAGGAGGAAAAAAGG - Intergenic
1163884483 19:19953756-19953778 CTCTTAGGAGGGACATAAAATGG - Intergenic
1165446597 19:35860203-35860225 CTCCTGGGATGGAGGAACCAGGG + Intronic
1165642648 19:37403258-37403280 CTCTTCGGATGGAGGAAGGGAGG - Intergenic
1165832770 19:38737387-38737409 TTCTAAGGGAGGAGGAAAAAAGG + Exonic
1166540323 19:43600872-43600894 CAGTTAGGAAGGTGGAAAAAAGG - Exonic
1166923814 19:46251633-46251655 CTCTTTGGTTGGATGAAAAAGGG + Intergenic
1168057756 19:53872960-53872982 CTCTTGAGAAGGAGGAAAATAGG + Intronic
1168481023 19:56719693-56719715 CTGCTGGGATGGAGGAAAGATGG + Intergenic
1168491132 19:56810206-56810228 CTCTTTGGATGGTGAAAACATGG + Exonic
925767715 2:7252919-7252941 CTCTGAGGATGCAGGAGGAAGGG + Intergenic
927739474 2:25554924-25554946 CTCTGAGGAAGGAGGAAAATGGG + Intronic
929532056 2:42759220-42759242 CTGCTGAGATGGAGGAAAAATGG - Intergenic
929944024 2:46356900-46356922 CCCTTGTGATGCAGGAAAAATGG + Intronic
930280666 2:49365517-49365539 CTCTTCAGATAAAGGAAAAAAGG + Intergenic
930549824 2:52819447-52819469 CTCATAAGAGAGAGGAAAAATGG + Intergenic
931356537 2:61541892-61541914 CTCTTGTGAAGGGGGAAAAAAGG + Intergenic
933088743 2:78092075-78092097 CACTTAAGCTGGAGGACAAAGGG + Intergenic
933423052 2:82076390-82076412 CTTCTAGGATGCAGGAAAACTGG + Intergenic
933572009 2:84025093-84025115 CTCTGAAGATGGAGGAAGGAGGG + Intergenic
933700726 2:85253710-85253732 CTCTTACGATGGTAGTAAAAAGG - Intronic
934568681 2:95354580-95354602 CTCCCAGGATGGAGGAGCAAGGG - Intronic
934899497 2:98146728-98146750 CTCCTAGTTTAGAGGAAAAAAGG + Intronic
937001816 2:118474566-118474588 CTCTCATGAAGGAGGAAAACAGG - Intergenic
938061548 2:128259072-128259094 TTCTCAGGCTGGAGGAATAAGGG - Intronic
938557681 2:132440417-132440439 CCCCTAGGAAGGAGCAAAAAGGG - Intronic
938735633 2:134184151-134184173 CTCTGATGATGGAGAAATAATGG + Intronic
940117776 2:150228118-150228140 ATGTTAGGATTGAGGAAATATGG - Intergenic
941012977 2:160322304-160322326 CTCTGAGTATGGAAGAAGAAGGG + Intronic
941232598 2:162930119-162930141 CTCTAAGGATGTAGGCATAAAGG + Intergenic
941777951 2:169413249-169413271 TTCCTAGGTTGGAGGAAGAAGGG + Intergenic
942095835 2:172535784-172535806 CTACAAGGATGGAAGAAAAAAGG + Intergenic
942552979 2:177139361-177139383 ATCTTGTGATGGAAGAAAAAGGG + Intergenic
942569364 2:177297767-177297789 CGCTTATGATGGATGAAGAAAGG + Intronic
945655879 2:212623202-212623224 CTCATAGGATGCAGCAAAAGGGG + Intergenic
946491857 2:220156341-220156363 TTGTTGGGTTGGAGGAAAAAAGG - Intergenic
948135478 2:235633092-235633114 CCCTTATGATGGAGAAGAAAGGG - Intronic
1169292008 20:4360829-4360851 CTCAAAGGATGTAGCAAAAAGGG + Intergenic
1169388230 20:5169000-5169022 CACTTAGGATGAAGGACACATGG - Intronic
1170208819 20:13827749-13827771 GTCTAAGGATGGAAGACAAAGGG - Intergenic
1172924057 20:38514291-38514313 CTCAAAGGCAGGAGGAAAAAGGG - Intronic
1173801956 20:45899588-45899610 GTGTGAGGATGGAGGAAGAAAGG - Intronic
1174058749 20:47817466-47817488 CTCTTTGGATGGGAGAAAACAGG + Intergenic
1174672737 20:52323180-52323202 CTCTTTGAATGGCAGAAAAAGGG - Intergenic
1174863410 20:54113702-54113724 CTCTTAGAAAGGAGTAAAGAAGG - Intergenic
1175108985 20:56632564-56632586 GATTGAGGATGGAGGAAAAATGG + Intronic
1175293558 20:57894122-57894144 CTTTTAGGATGGAGAGATAATGG + Intergenic
1175769800 20:61616482-61616504 CTCTTACTGTGGAGGAAAAAAGG - Intronic
1175929388 20:62486502-62486524 CTCTTAGGATGGAGAAACCGAGG - Intergenic
1176889158 21:14293514-14293536 CTCTTATGATGGATGAAAAGAGG - Intergenic
1176904616 21:14484386-14484408 CCTTTAGGATGGAGGAAAGAGGG + Intergenic
1176934762 21:14853670-14853692 CTCATAAGATGGAGGCAAGAAGG + Intergenic
1177627728 21:23685484-23685506 CTATCAGGCTGTAGGAAAAAGGG - Intergenic
1177731540 21:25033719-25033741 CGTTTAGTGTGGAGGAAAAATGG - Intergenic
1178785910 21:35653024-35653046 CTCTTGGACTGGAGGAACAATGG - Intronic
1179163277 21:38915148-38915170 CTCCTAGAAGGGAGGAACAAAGG - Intergenic
1180120965 21:45747819-45747841 CTCAGAGGAGGGAGGAAAGAAGG - Intronic
1181835602 22:25605497-25605519 CTCTGAGAGTGGAGGGAAAAAGG + Intronic
1183818960 22:40328801-40328823 CTCTGAGGATGGGGAAAAAATGG - Exonic
1184612349 22:45612862-45612884 CTCTGGGGAAGGAGGAAAACAGG + Intergenic
949117751 3:348580-348602 ACCTTAGTAAGGAGGAAAAAAGG - Intronic
949929456 3:9067283-9067305 TTTTTAGGATGAAGGAAGAAGGG - Intronic
950982979 3:17328974-17328996 CACTGAGGAAAGAGGAAAAAAGG + Intronic
951040699 3:17986355-17986377 TTCTGAGGATGGAGGTATAAGGG + Intronic
951414174 3:22402812-22402834 TTATTAGGTTGGTGGAAAAATGG + Intergenic
952827435 3:37536092-37536114 GTCTTCAGATGGAGGAAAGATGG + Intronic
952913795 3:38214857-38214879 ATCTAAACATGGAGGAAAAAGGG + Intronic
955736090 3:62039832-62039854 CTCTGTGGCTGGGGGAAAAAAGG - Intronic
956598465 3:70994051-70994073 CTCTTAGAATCAAGGAAATAGGG + Intronic
956859810 3:73311541-73311563 TTCTAAGGATGGAGAACAAATGG - Intergenic
957611363 3:82471646-82471668 CTCTTATGATGGAAAAGAAAGGG - Intergenic
960156553 3:114302222-114302244 AACTTAGGATGGAGGATAAGGGG + Intronic
960864894 3:122189522-122189544 CACTGAGGGTGGAGGAAAACAGG - Intronic
962041183 3:131708784-131708806 TACTGAGGATGCAGGAAAAAAGG + Intronic
962152953 3:132912292-132912314 CCCTTAGGCTGGAGGGATAAAGG + Intergenic
962171495 3:133105923-133105945 CTCTTAGGGTGGTGGCTAAAGGG + Intronic
962917694 3:139920200-139920222 CTCTGAGGATTGAGATAAAAAGG - Intergenic
963092004 3:141490965-141490987 CTCTTAGGAAGGAGTAAAGTAGG + Intronic
963105327 3:141642212-141642234 CTGTTAGGCTGAAGGCAAAATGG + Intergenic
963323112 3:143831103-143831125 CTCTTAAAATGGAAAAAAAAAGG + Intronic
963395189 3:144723357-144723379 CTCTTAGGATAGATTAGAAATGG + Intergenic
963931983 3:151012891-151012913 CTCCTAGGATATAGGAAACAGGG - Intergenic
964345669 3:155752188-155752210 CTCTTAGGAAGGAGGAAAAGGGG - Intergenic
965455297 3:168892136-168892158 ATCTTAGAGTGGAGGAAAACTGG + Intergenic
967071408 3:185965568-185965590 ATCCTAGGAGGGATGAAAAAGGG + Intergenic
967098743 3:186198467-186198489 CTCTAGGGATGGAGCAGAAATGG + Intronic
968415144 4:425590-425612 ATTTTAGGATGAAGGAAACAAGG - Intergenic
969499192 4:7542896-7542918 CTCTTAGGAGGGATGAAAGCAGG + Intronic
969646982 4:8436481-8436503 CTGTTAAGATCTAGGAAAAAGGG + Intronic
969695866 4:8734536-8734558 TGATGAGGATGGAGGAAAAAGGG - Intergenic
970004496 4:11397442-11397464 CTCTTAGGATGGAAGATATTTGG + Exonic
970052707 4:11933317-11933339 CTCTTAGAATGTAGTAAAGAAGG + Intergenic
970370838 4:15405006-15405028 CACTTAGGATTGAGAAAAAGTGG - Intronic
971262379 4:25069170-25069192 CTCTTAGGCTGGAGGGACAGAGG + Intergenic
971903418 4:32694366-32694388 CACTGAGGATGAATGAAAAAAGG + Intergenic
972385609 4:38562828-38562850 CTCCTAGGCTGGAGGGACAAAGG + Intergenic
973029939 4:45324997-45325019 CACTCAGGATGGAAGGAAAAGGG - Intergenic
975439316 4:74392813-74392835 AGTTTAGGAAGGAGGAAAAATGG + Intergenic
977723860 4:100271362-100271384 CTCTTGTGGTGGAGGAAAGAGGG + Intergenic
977765966 4:100798012-100798034 CTCCTAGGCTGAAGGAAAGATGG + Intronic
977909634 4:102518053-102518075 CTCCTAGGATGTTGGAAAGAAGG + Intronic
978297151 4:107218739-107218761 CCCATAGAAGGGAGGAAAAAGGG - Intronic
979639362 4:122995571-122995593 CTTTTATAAAGGAGGAAAAATGG + Intronic
981836348 4:149058854-149058876 CAATAAGGATGGAGGAAAGAGGG - Intergenic
982626151 4:157768782-157768804 TTCTTAGGATTGAAGAAAAACGG + Intergenic
983287526 4:165758798-165758820 CTGTTAGGATGCAGAAGAAAAGG + Intergenic
984249437 4:177314263-177314285 TTCTTACAAAGGAGGAAAAAGGG + Intronic
984521724 4:180810138-180810160 CTGTTTGGAAGGATGAAAAAGGG + Intergenic
984851966 4:184162267-184162289 CTCATAGGGTGCTGGAAAAAAGG + Intronic
985247028 4:187989276-187989298 CTCATAAGATGGAGGGGAAAAGG + Intergenic
985490792 5:177723-177745 GTCTTAGGATCAAGGATAAATGG - Intronic
985904515 5:2823087-2823109 CTCTGAGGAAGAAGGAAAACGGG + Intergenic
986040003 5:3984181-3984203 CTCTTGAGGTGGAGGAAAATTGG + Intergenic
986264416 5:6180534-6180556 CCCTCAGGATGGAGGGAAAGAGG - Intergenic
986289925 5:6391562-6391584 CCCTGAGGATGGAGGAGCAATGG + Intergenic
986440888 5:7780784-7780806 CACTTCAGATGGAGTAAAAAAGG - Intronic
988054911 5:26082191-26082213 CTTTTAGGAAGGAAGAAAACTGG + Intergenic
988350609 5:30101372-30101394 CACTTAGGATGCAATAAAAAAGG + Intergenic
989144805 5:38238205-38238227 CTCTGAGGAAGAAGGAAAAAGGG + Intergenic
989196608 5:38722800-38722822 CTATTAGGATGGTGGAACAGAGG + Intergenic
990875298 5:60477521-60477543 CTGTTAAGATGGAGGAAAAAAGG + Intronic
991052359 5:62287023-62287045 CTCAAAGGAAGGAGAAAAAATGG - Intergenic
991362605 5:65836551-65836573 CTGTTAGGAAGGAGGAAAAAGGG - Intronic
991496872 5:67235457-67235479 CTCTTAAGATGGAAATAAAATGG + Intergenic
991674371 5:69076437-69076459 CCTTTATGAAGGAGGAAAAAAGG + Intergenic
991949919 5:71937797-71937819 GTTCTAGGGTGGAGGAAAAACGG - Intergenic
992859826 5:80898844-80898866 CTCCTTGGAGGGATGAAAAAGGG - Intergenic
993372083 5:87105408-87105430 CTCTTAGGTTGGAGGAACAAAGG + Intergenic
993531357 5:89028681-89028703 TTCTTAGGCTGAAGGAGAAAAGG - Intergenic
994960111 5:106588976-106588998 TTCTTAGCAGTGAGGAAAAAAGG + Intergenic
994964384 5:106649540-106649562 CTCATAAGATGGATGAATAAAGG + Intergenic
996026558 5:118652912-118652934 CTTTTGTGATGGGGGAAAAATGG + Intergenic
996035846 5:118757979-118758001 CTCTGAGGATGGAGAACAAGTGG - Intergenic
999231811 5:150066140-150066162 CTCTTGGGATGGTGGAAGGAGGG - Intronic
999793065 5:154960966-154960988 CTCTCCAGATGGAGGAGAAAGGG + Intronic
1001243255 5:170086269-170086291 ATCTTAGGGTGAAGGAAAGAGGG + Intergenic
1001922858 5:175614039-175614061 GGCTGAGGATGGAGGGAAAATGG + Intergenic
1002017862 5:176340086-176340108 CTCTCAGCATGGAGGAAGAAAGG + Intronic
1002490042 5:179569322-179569344 CTTTAATGATGGAGGAAGAAGGG + Exonic
1003291194 6:4779658-4779680 CTGCTAGGATTGAGGAAAAACGG + Intronic
1005077848 6:21926084-21926106 TTCTTTGGAAGGAGGAAAACAGG - Intergenic
1005531684 6:26713504-26713526 CTGTGAGGAGGGAGGAGAAAAGG - Intergenic
1005539111 6:26788161-26788183 CTGTGAGGAGGGAGGAGAAAAGG + Intergenic
1006134769 6:31888745-31888767 CCCCTTGGATGGAGGAAAAGAGG + Exonic
1006180314 6:32150269-32150291 CTGGTAGGATAGAGGAACAAGGG - Intronic
1006265236 6:32916062-32916084 CTCTAATAATGGAGGAAAAAGGG + Intergenic
1007518056 6:42429230-42429252 TGCTCAGGATGGAAGAAAAAAGG - Intronic
1008338294 6:50333385-50333407 CTATGAGGAGGAAGGAAAAAAGG + Intergenic
1008712778 6:54248671-54248693 CTCTTGGGATGGAAGAGGAAAGG + Intronic
1009009945 6:57830387-57830409 CTGTGAGGAGGGAGGAGAAAAGG + Intergenic
1010390860 6:75335529-75335551 CTCTCAGGGAGAAGGAAAAAAGG - Intronic
1010807049 6:80249650-80249672 CTCTTGGGGTGGAGGTAAGAGGG + Intronic
1011466363 6:87661457-87661479 CTCTTGAGATGGGGGAGAAAAGG + Intronic
1012737516 6:102969046-102969068 CTTTTAAGATGGAAGAAAGATGG - Intergenic
1014024111 6:116624938-116624960 CTCATATGATGGAGTAAACATGG + Intronic
1014080135 6:117276445-117276467 ATCTAAGCATGGAAGAAAAATGG + Intergenic
1014248395 6:119092007-119092029 CTCTTAGCAATGAGGAAAAGAGG - Intronic
1014770730 6:125455303-125455325 CTCTCTGGATGGAGGAAAAGGGG - Intergenic
1014896361 6:126904818-126904840 GTATTAGGATGCACGAAAAAAGG - Intergenic
1015022013 6:128487684-128487706 TTCTTAGGATTGATGAAGAATGG - Intronic
1015846434 6:137525109-137525131 CTCTTATGATGGGTGAGAAAAGG - Intergenic
1016430016 6:143973563-143973585 GTTGTAGGATGGAGGAAGAAAGG - Intronic
1017955500 6:159174347-159174369 CTTTTAGGAGGGAGGAAAACGGG - Intronic
1018474704 6:164129270-164129292 CTTTGAGGATAGAGGAAAACAGG + Intergenic
1020020477 7:4863942-4863964 CTCTAGGGCTGGAAGAAAAAGGG - Intronic
1020034050 7:4953135-4953157 CTGTAGGGATGGAGGAAACAGGG - Intronic
1020149220 7:5668618-5668640 GTCAAAGGAGGGAGGAAAAAAGG + Intronic
1020559249 7:9709115-9709137 TGCTTAGGATGCTGGAAAAATGG + Intergenic
1020597792 7:10231060-10231082 CTCTTTTCATGAAGGAAAAAAGG - Intergenic
1021205358 7:17773516-17773538 CTCCCAGGATGGATGAACAAGGG - Intergenic
1021598855 7:22344140-22344162 CTCTTTGGGTGGAGGATAGAGGG - Intronic
1022520951 7:31006600-31006622 CTCTGAGGCAGGAGGGAAAAGGG - Intergenic
1022602457 7:31774231-31774253 CTCTCAGAATGGATGAAATATGG + Intronic
1022881273 7:34590196-34590218 TACTTGGGAAGGAGGAAAAAGGG - Intergenic
1023168832 7:37370474-37370496 CTCTTATGATGGGGAGAAAAGGG + Intronic
1024213823 7:47229486-47229508 CTGTTAGCATGGGGAAAAAAAGG + Intergenic
1027209684 7:76135537-76135559 CTCCTGGGTTGGAGGCAAAAGGG - Intergenic
1027287145 7:76658364-76658386 CTCTTAGAAGGGAGGCAACATGG - Intergenic
1027522640 7:79229396-79229418 CTTGTAGGTTGGAGGAAAGATGG - Intronic
1027756398 7:82218297-82218319 CACTTAAGATGTAGGAAAACAGG + Intronic
1028315209 7:89393172-89393194 CTTTTAGGAAGGAGTAAAAATGG - Intergenic
1028425984 7:90689421-90689443 CTCTTAAGATTGAGCAAGAATGG + Intronic
1029930907 7:104370113-104370135 CTCTAAGGATGGAGGAACAAAGG + Intronic
1029956743 7:104648341-104648363 GTCTTAGAATGGAGGAAATATGG - Intronic
1030900959 7:115122669-115122691 CTCATAGGAGGGAGCAAAACAGG + Intergenic
1031048046 7:116915432-116915454 CTCCTAAGATAGAGTAAAAATGG - Intronic
1031867316 7:127051901-127051923 CCCTTAGGAAAGAGGAAGAAGGG + Intronic
1031916318 7:127566120-127566142 CTCTGAGGATGGAGCCAACATGG - Intergenic
1032067645 7:128783572-128783594 CTTCTAGGATGGAAGCAAAAAGG + Intergenic
1032321603 7:130890853-130890875 CTCTTGGGATGGAGTAAAGGGGG - Intergenic
1034831010 7:154307429-154307451 CTCTGAGGAGGGAGAAAAAGCGG - Intronic
1034999934 7:155604399-155604421 CTCTGAGGATGGAGGTGAGAGGG + Intergenic
1035117933 7:156540485-156540507 ATTTTAAAATGGAGGAAAAAAGG - Intergenic
1036237233 8:7050634-7050656 ATCTTAGGATCAAGGAAATATGG - Intergenic
1036291051 8:7490945-7490967 CCCTAAGGTTTGAGGAAAAATGG - Intergenic
1036330439 8:7820591-7820613 CCCTAAGGTTTGAGGAAAAATGG + Intergenic
1036428889 8:8671283-8671305 CTCTTAGGATGACTGTAAAATGG + Intergenic
1036579566 8:10061406-10061428 CACTTAGGTTGGAGAGAAAAAGG - Intronic
1036624008 8:10450520-10450542 CTGGTAGGATGGAGGTAAAGTGG + Intergenic
1037378674 8:18261164-18261186 CTCTTAGGGGAAAGGAAAAAGGG - Intergenic
1037450914 8:19014453-19014475 ATCAAAGGACGGAGGAAAAAAGG - Intronic
1037634665 8:20691084-20691106 CTCTTAAGACTGAGGAAATATGG + Intergenic
1037680211 8:21091006-21091028 TTCTTAGGATTGAGAAAAATTGG + Intergenic
1038023928 8:23572554-23572576 CTCTTTTCATGGGGGAAAAAAGG + Exonic
1038653895 8:29431076-29431098 CTATTAGGATAATGGAAAAACGG + Intergenic
1039016851 8:33159115-33159137 AAGTAAGGATGGAGGAAAAAAGG - Intergenic
1039410669 8:37352600-37352622 CTGTCAAGAAGGAGGAAAAATGG + Intergenic
1040987993 8:53317370-53317392 CTCTTAGGAAAGAGAAAAAAGGG + Intergenic
1041875118 8:62678957-62678979 CTCTTAAGATATATGAAAAAAGG + Intronic
1041989835 8:63973582-63973604 CTCTGAGGATGTTAGAAAAATGG + Intergenic
1042778885 8:72467998-72468020 CTCTCAGGATGGAGCAGAAATGG + Intergenic
1043679450 8:83003880-83003902 TTCTTAAAATGGAAGAAAAAGGG + Intergenic
1043690216 8:83141609-83141631 TTCTAAGGATAGAGCAAAAAGGG + Intergenic
1043977089 8:86595685-86595707 TTTTTAGGAAAGAGGAAAAAAGG + Intronic
1044727665 8:95206632-95206654 CTGTTGGGAAGGAGGAAAGAGGG - Intergenic
1045931828 8:107635972-107635994 CACTGAGGATTGAGGAGAAAGGG + Intergenic
1046419889 8:113966768-113966790 CTCTAAGGACTGAGGAGAAATGG - Intergenic
1046677638 8:117128772-117128794 CCTTTAGTATGAAGGAAAAAGGG + Intronic
1047566220 8:126046969-126046991 CCCTGAGTATGAAGGAAAAAGGG + Intergenic
1048090952 8:131239672-131239694 GTCTTAAGGAGGAGGAAAAAGGG - Intergenic
1050651209 9:7778837-7778859 TTCCCAGGAAGGAGGAAAAATGG - Intergenic
1051565029 9:18487880-18487902 GTCTTAGGATCGATGAAATACGG - Intronic
1053000969 9:34577271-34577293 CTTTTAGGATGGAGGCATCAGGG - Intronic
1053226347 9:36361474-36361496 TTCTTAGTATGGGGAAAAAATGG - Intronic
1057989992 9:99758567-99758589 CTCTTACCCTGGAGGTAAAATGG - Intergenic
1059163797 9:112060119-112060141 CTCTTAGGAAGCAGGAGATAGGG - Intronic
1060138709 9:121184501-121184523 CTGTTTGGAAGGGGGAAAAAGGG - Intronic
1061658717 9:132113333-132113355 CACTTTGAATGGAGGATAAAGGG + Intergenic
1185734249 X:2485463-2485485 TTCTCAGGAGGGAGGAAAAGAGG + Intronic
1185913854 X:4012598-4012620 CTCTTGGGATGTGGGTAAAAAGG + Intergenic
1186371959 X:8955877-8955899 CTCATGAGATGGAGGAAAGAGGG - Intergenic
1187807274 X:23134645-23134667 CCCTTTGGATGTAGGAAAAATGG - Intergenic
1188458694 X:30397083-30397105 CTCTTAGGGGGGGGAAAAAAAGG + Intergenic
1188747574 X:33864933-33864955 CTCTTTGGATTGAGGAAAATGGG - Intergenic
1189084677 X:38009631-38009653 CTCTTAGACTGAGGGAAAAAAGG - Intronic
1189644670 X:43115058-43115080 CTCTCAGAATGTAGGAAAAGAGG + Intergenic
1191652341 X:63553152-63553174 ATCTTAGAATTGAGGAAATACGG - Intergenic
1193298794 X:79864528-79864550 CTCCCATGTTGGAGGAAAAAAGG - Intergenic
1193882290 X:86937568-86937590 CTCTTAGAAGGCAGGAATAATGG - Intergenic
1193919912 X:87412586-87412608 CTCTTAGAATGAAAGAAATATGG + Intergenic
1194620322 X:96162927-96162949 CCCTTATGATGGATGAGAAAAGG + Intergenic
1195046882 X:101062572-101062594 GTCTAAGGAAGGAGAAAAAAAGG - Intergenic
1195740307 X:108058669-108058691 CTCTTCAGATGGATGAAGAAGGG + Intronic
1196108179 X:111918196-111918218 CTCAGAGACTGGAGGAAAAAAGG + Intronic
1197801184 X:130351100-130351122 GTTTTAGGATGGAGTACAAATGG - Intronic
1197869339 X:131050650-131050672 CTCCTGGGATGGAGGAATACAGG + Intergenic
1199243968 X:145581323-145581345 CTCTTACAGTGGAGGAAAAAAGG - Intergenic
1199882843 X:151988636-151988658 CTCTTAGAAAGCAGGAAAGATGG + Intergenic
1200058229 X:153472544-153472566 CTCTCAGGAAGGGGGAAAGAAGG + Intronic
1200453009 Y:3353907-3353929 CTTTAAGGATGCTGGAAAAAAGG + Intergenic
1201675893 Y:16583772-16583794 CACTCATGATGGAAGAAAAAGGG + Intergenic
1201693972 Y:16804124-16804146 CTTTTAGTATGGAGGAGACAAGG + Intergenic