ID: 1117536455

View in Genome Browser
Species Human (GRCh38)
Location 14:56707558-56707580
Sequence GAGGAGAATCTGCTGGAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 359
Summary {0: 1, 1: 0, 2: 7, 3: 20, 4: 331}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117536455_1117536459 2 Left 1117536455 14:56707558-56707580 CCCTGCTCCAGCAGATTCTCCTC 0: 1
1: 0
2: 7
3: 20
4: 331
Right 1117536459 14:56707583-56707605 AGCTGAGTACAGTGATCATCAGG 0: 1
1: 0
2: 1
3: 12
4: 104
1117536455_1117536462 23 Left 1117536455 14:56707558-56707580 CCCTGCTCCAGCAGATTCTCCTC 0: 1
1: 0
2: 7
3: 20
4: 331
Right 1117536462 14:56707604-56707626 GGGCTGAGAAGCGCTGAGAAGGG 0: 1
1: 1
2: 3
3: 30
4: 278
1117536455_1117536461 22 Left 1117536455 14:56707558-56707580 CCCTGCTCCAGCAGATTCTCCTC 0: 1
1: 0
2: 7
3: 20
4: 331
Right 1117536461 14:56707603-56707625 AGGGCTGAGAAGCGCTGAGAAGG 0: 1
1: 1
2: 3
3: 39
4: 326
1117536455_1117536460 3 Left 1117536455 14:56707558-56707580 CCCTGCTCCAGCAGATTCTCCTC 0: 1
1: 0
2: 7
3: 20
4: 331
Right 1117536460 14:56707584-56707606 GCTGAGTACAGTGATCATCAGGG 0: 1
1: 0
2: 1
3: 17
4: 115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117536455 Original CRISPR GAGGAGAATCTGCTGGAGCA GGG (reversed) Intronic
900987105 1:6079424-6079446 CAGGAGAATCTCCTGAAGCCAGG + Intronic
904029530 1:27525666-27525688 GAGGAGGAACTGCTGGATGAGGG + Intergenic
904419550 1:30382773-30382795 CAGGAGCATCTGCTGGGGCGGGG + Intergenic
904610764 1:31725108-31725130 GAGTAGGATCTGCTGGTACATGG + Intergenic
905780046 1:40700906-40700928 GTGGAGAATAAGCTGGAGAAGGG - Intronic
906772119 1:48494595-48494617 GAGTATACTCTGATGGAGCAAGG - Intergenic
907164486 1:52398354-52398376 CAGGAGAATCTCCTGAACCAGGG - Intronic
907274623 1:53310312-53310334 GAGGAAGACCTCCTGGAGCATGG - Intronic
907275975 1:53316838-53316860 GAGGAGAGGCTGCTGTGGCAGGG + Intronic
907401781 1:54228930-54228952 GAGCAGAGCCTGCCGGAGCAGGG - Intronic
908495268 1:64688598-64688620 GAGGACAGGGTGCTGGAGCATGG - Intronic
908778045 1:67660622-67660644 GAGAAGCATGTGCTGGATCACGG + Intergenic
909687968 1:78372225-78372247 GAGGAGAATCGCTTGGACCAGGG + Intronic
911192527 1:94961950-94961972 GAGGAGATTTTGCTGTAGAAAGG + Intergenic
912430202 1:109624804-109624826 GTGGAGAATCTGCTAGTCCAGGG + Intronic
912723763 1:112041546-112041568 AAGGAGAATTTCCTGGAGCTGGG - Intergenic
914815638 1:151060004-151060026 GAGGCGAGTCTGGAGGAGCAGGG + Exonic
915546129 1:156598979-156599001 GAGGAGCAGCTGCTAAAGCATGG - Exonic
915937128 1:160096152-160096174 CAGGAGTATCTGCTGGGGTAGGG - Intronic
916791628 1:168130206-168130228 GAGGAGCAACTGCTGGACAAGGG - Intronic
918462786 1:184793461-184793483 GAGGAGAATCTCCTGAACCCAGG + Exonic
920050101 1:203159230-203159252 GTGGAGAATGTGTTGCAGCAGGG - Intronic
920259209 1:204677590-204677612 GAAGAGAAGCTGCTGCAGCCTGG + Intronic
921647622 1:217636503-217636525 CAGGAGAATCTGCTGAACCTGGG - Intronic
921901111 1:220451797-220451819 GAAGAGAGTCTGCTAGAGCCAGG - Intergenic
922606098 1:226890882-226890904 GAGGAGAATCGCCTGCAGCGTGG + Intronic
924150157 1:241121808-241121830 GAGGAGAATCTGCTTGAGCTAGG - Intronic
924808673 1:247382094-247382116 CAGGAGAATCTGCTTGAGCCTGG + Intergenic
1062984710 10:1757483-1757505 GAGGAGGACCTTGTGGAGCAAGG - Intergenic
1063255212 10:4320183-4320205 GAGAAGAACCTGCAGGAGTAAGG + Intergenic
1063278404 10:4597197-4597219 GAGGAGCAGATGCAGGAGCAGGG - Intergenic
1064083614 10:12328316-12328338 CAGGAGAATCACTTGGAGCAGGG - Intergenic
1064123594 10:12640122-12640144 GAGGAGAAATTGCTGGGGCTAGG - Intronic
1065453181 10:25880004-25880026 GAGCAGCATCAGCTGGAGGAAGG + Intergenic
1065771971 10:29086126-29086148 GAGAGGAATCTGCTGAAGAAAGG + Intergenic
1069201191 10:65618745-65618767 GAGGTGAATTTGGTGGGGCAGGG + Intergenic
1069479151 10:68765174-68765196 GAGGAGAAACTGCTGGGACTAGG - Intronic
1069498041 10:68924773-68924795 GAGGAGAAACTGCTGGACAGAGG - Intronic
1069652568 10:70060275-70060297 CAGGAGAATCTCCTGAACCAGGG + Intronic
1069756549 10:70777301-70777323 GAGGAGCCTCTGCGGGAGCAGGG - Exonic
1069917276 10:71795492-71795514 GAAGAGAGTCAGCTGGAGGAAGG - Intronic
1071726461 10:88202770-88202792 GAGGTGAATCTGAGGGACCAGGG - Intergenic
1072454309 10:95562455-95562477 GTGGGGAATCTGCTGGCCCAAGG + Intergenic
1072682547 10:97517381-97517403 GAGGAGGAGCTGCTGGAGAATGG + Intronic
1073105651 10:101030923-101030945 GGGGAGGATCTGCTGGAGAGGGG + Intronic
1073857891 10:107698327-107698349 GATGGGAATATGCTGGAGTAGGG + Intergenic
1075141281 10:119838552-119838574 GATGAGACTCTCCTGGAACAGGG - Exonic
1075477972 10:122753035-122753057 AAGGAGAATTTGCAGGAGTATGG - Intergenic
1075623755 10:123947089-123947111 CAGCAGAATCTGCTAGAGCCTGG - Intergenic
1075626400 10:123967140-123967162 GAGGAGGAGCCGCTGGAGCTGGG - Intergenic
1076381917 10:130029241-130029263 GATGAGATCCTGCTGGAGGAGGG - Intergenic
1076559139 10:131349771-131349793 GAGCAGGAGCTGCTGGAGTAAGG - Intergenic
1077269185 11:1667132-1667154 GAGAAGAATCTGCTGGGATAAGG + Intergenic
1077271362 11:1683582-1683604 GAGAAGAATCTGCTGGGATAAGG - Intergenic
1077978518 11:7275155-7275177 AGGGAGAATCTGCTGGAGCAGGG - Intronic
1078080600 11:8202005-8202027 GACTAGAATATGCTGGAGGAGGG - Intergenic
1078224732 11:9381798-9381820 CAGGAGAATCACCTGGACCAGGG - Intergenic
1079381329 11:19940501-19940523 GACTAGAAGCTGCTGGAGCTTGG - Intronic
1080588507 11:33701176-33701198 GAGGTAAGTCTGCTGGTGCAGGG - Intronic
1081453144 11:43192875-43192897 CAGGAGAATCTCCTGAACCAGGG - Intergenic
1081629144 11:44676404-44676426 CAGGAGAATCTGTTGGACCTGGG - Intergenic
1081734441 11:45393269-45393291 GAGGAGAACTGGCTGGATCACGG - Intergenic
1083169291 11:60913371-60913393 GAGGAGAAGCAGCTGGATGAGGG - Intergenic
1083569888 11:63754170-63754192 TAGGAGAATCTACTTGAGCCTGG + Intronic
1084474945 11:69383542-69383564 GAGAAGAAAAAGCTGGAGCATGG + Intergenic
1086852638 11:91828416-91828438 AAGGAGAGTCTGCAAGAGCATGG - Intergenic
1090364915 11:126197803-126197825 GAGCAAAATCTGCTGGCTCAGGG - Intergenic
1090418838 11:126559428-126559450 GTAGAGAATCAGCTGGAGGAGGG - Intronic
1093923687 12:24888404-24888426 GAGGAGAATCTGTTGAAGCCAGG + Intronic
1096754166 12:53784985-53785007 AAGGAGAATCTTTTGTAGCAAGG - Intergenic
1098258039 12:68637502-68637524 GAGGAGAATCAGTTGAACCAGGG + Intronic
1098342193 12:69463773-69463795 GAGAAGAATGGGCTGGGGCATGG + Intergenic
1098936874 12:76490419-76490441 GAGGAGAAGCTGCTGGACGTCGG + Intronic
1099055914 12:77840436-77840458 GAGGAGAATATGATGGAGCAAGG + Intronic
1099357049 12:81650542-81650564 AAAGAGAATGTTCTGGAGCAAGG + Intronic
1100262703 12:92948006-92948028 GAGGAGAAACTAATGGAGTAAGG + Intergenic
1100367395 12:93934303-93934325 CATGAGAATCTGCTTGAGCCCGG + Intergenic
1100818417 12:98407890-98407912 TAGGAGGATCTGCTTGAGCCTGG + Intergenic
1101598600 12:106189133-106189155 GAGGAGAATGTGCTGGAGAGTGG - Intergenic
1101755517 12:107618095-107618117 GAAGTGGATCTGCTGGGGCAGGG - Intronic
1103904064 12:124318549-124318571 GAGGAGAAGCTGCAGGAGGTCGG - Intergenic
1105735638 13:23267309-23267331 GAGGAGTGTCTACAGGAGCATGG + Intronic
1105764824 13:23548730-23548752 CAGGAGAATCTGCTTGAACCTGG + Intergenic
1107242950 13:38259476-38259498 CAGGAGAATCTCTTGAAGCAGGG + Intergenic
1107817522 13:44257224-44257246 GAGGAGCATCTGCTGGGGGTGGG + Intergenic
1108568846 13:51729520-51729542 GAGAAGAATGGGCTGGAGGAAGG - Intronic
1108863075 13:54886376-54886398 GGGAAGAAACTGCTGTAGCATGG - Intergenic
1109272785 13:60272823-60272845 GAGGAAAATCTGCTTGAGTGTGG + Intergenic
1110123714 13:71914473-71914495 GATGAGAATCTGCTGAAATATGG - Intergenic
1112426051 13:99302271-99302293 GAGGAAAAATTTCTGGAGCAGGG + Intronic
1113108533 13:106797432-106797454 CAGGAGAATCTGCTTGAACCTGG + Intergenic
1113885165 13:113655046-113655068 GAGGAGAATGTTCTGGAACTAGG - Intronic
1114430915 14:22659732-22659754 TAGGAGGATCTGCTTGAGCCAGG + Intergenic
1115951648 14:38728223-38728245 GAGGAGAACCGGCTGGAGTTTGG + Intergenic
1115990617 14:39146037-39146059 CAGGAGAATCAGCTGGACCTGGG - Intergenic
1116326874 14:43541111-43541133 GAGGAGAGCCTGCTGGAGTCTGG - Intergenic
1117000918 14:51370420-51370442 CAGGAGAATCTGTTGAACCAGGG - Intergenic
1117066361 14:52016050-52016072 GAGGAGAGGATGCTGGAGAAAGG - Intronic
1117536455 14:56707558-56707580 GAGGAGAATCTGCTGGAGCAGGG - Intronic
1118903395 14:70005058-70005080 GAGGAGGAACTGCTGAAGAAAGG - Intronic
1118992982 14:70812337-70812359 GAGGGGAATGGGGTGGAGCAGGG + Intergenic
1119474069 14:74917105-74917127 CAGGAGAAGCAGCTGGAGTAAGG + Intronic
1120790772 14:88579542-88579564 GAGTGGAATCAGATGGAGCAGGG + Intronic
1121343171 14:93116645-93116667 AAGGAGATTTTGATGGAGCAGGG + Intergenic
1122690116 14:103528307-103528329 GAGGAGGTGCTGCTGGAGGATGG - Intergenic
1122700244 14:103583446-103583468 CAGGAGAATTTGCTGGAACCCGG + Intronic
1122890266 14:104729017-104729039 GAGGAGAAGGCTCTGGAGCATGG + Intronic
1123484155 15:20670003-20670025 GAGGAGAATGGGCTGAACCAGGG + Intergenic
1124661598 15:31554525-31554547 GAGGGGAATCTGCCAGAGAATGG - Intronic
1124924203 15:34055410-34055432 CAGGAGAATCTCCTGGATCCGGG + Intronic
1126034971 15:44537240-44537262 GAGGAGAAGTTGCTGGGGCAGGG + Intronic
1126314367 15:47353657-47353679 GAAGATAAACTGCTGGAGCCTGG + Intronic
1127664411 15:61131388-61131410 CAGCAGCATTTGCTGGAGCAAGG + Intronic
1127774439 15:62254245-62254267 CAGGAGAGGCTGCTGGAGCTGGG - Intergenic
1128455947 15:67831510-67831532 GAGGAGCCTCTCCTGGAGGAGGG + Intronic
1128480663 15:68035166-68035188 TAGGAGGATCTGCTTGAGCCTGG - Intergenic
1129328257 15:74813219-74813241 GAGGAGAAACAGCTTGGGCAGGG - Intronic
1130900434 15:88202894-88202916 CAGGAGAATCTGGTTGGGCAGGG + Intronic
1132537333 16:489010-489032 GAGGAGGGTGTGCTGGAACAAGG - Intronic
1132640000 16:973589-973611 GATGAGAATCTTCTGGAACTAGG + Intronic
1134071386 16:11262049-11262071 GAGGAGACTCGTCTGGAGGAAGG + Intronic
1134465888 16:14477346-14477368 CAGGAGAATCTCCTGAACCAGGG + Intronic
1135151139 16:20007051-20007073 TAGTTCAATCTGCTGGAGCAGGG + Intergenic
1135408477 16:22215376-22215398 GAGGAGAGTTTGGTGGTGCATGG + Intronic
1136037494 16:27550999-27551021 GAGGACAATCAGCTGGTGCTTGG - Intronic
1137292976 16:47064825-47064847 GAGGGCAGTCTCCTGGAGCAGGG + Intergenic
1138982042 16:62281380-62281402 CAGGAGAATCGGCTTGAGCCCGG - Intergenic
1139472347 16:67184908-67184930 GAGGAAAAGCTGCTGAAGCTGGG + Exonic
1140066420 16:71615293-71615315 CAGGAGAATCTGCTTGAACCCGG - Intergenic
1141192506 16:81834711-81834733 GAGGAGAACCCACTGGACCAAGG + Intronic
1141362170 16:83406012-83406034 GGGGAGAAGCTGCTGGAAGAAGG - Intronic
1141380888 16:83575622-83575644 GAGGACAATAGGATGGAGCAAGG - Intronic
1141874190 16:86810518-86810540 GAGGAGCATCAGCTGGAGTTGGG - Intergenic
1141942846 16:87289848-87289870 GAGGAGAATCAACTGAAGCCAGG - Intronic
1142575355 17:903473-903495 TGGGAGAATCTGCTTGAGCCTGG - Intronic
1142704244 17:1684471-1684493 GAGGAGAAGCTGCAGGAGAAAGG - Exonic
1143054572 17:4153296-4153318 GAGGAGAGTGTGCTGGGTCAGGG + Intronic
1143835253 17:9686845-9686867 GAGGATAGACTGCTGGAGCTGGG - Exonic
1144011846 17:11156403-11156425 GAAGAGTATCGGCTGGGGCATGG - Intergenic
1146475904 17:33162600-33162622 GAGGAGAAGTGGCTGGAGGAGGG - Intronic
1146968353 17:37052256-37052278 CTGGAGAATCTGATGGAACAAGG + Intronic
1147760746 17:42796061-42796083 GAGGAGAACCTGGGAGAGCAAGG + Intronic
1147978413 17:44260709-44260731 GAGGAGAACCTGGGGGAGAATGG - Exonic
1147994678 17:44354277-44354299 GAGAAGAAGCTGCTGGAACTGGG - Exonic
1148190056 17:45672137-45672159 GAGGGGCAGCTGCTGGAGCTGGG - Intergenic
1148633932 17:49132836-49132858 GAGGTGAAACTTCGGGAGCAGGG + Intronic
1149538989 17:57454527-57454549 CAGGAGAATCGCCTGGACCAGGG - Intronic
1150453415 17:65288135-65288157 GATGAGATCCTGCTGGAGAAGGG + Intergenic
1151802813 17:76387679-76387701 GAGGAGACTCCTCTGGAGAAGGG + Exonic
1152757038 17:82091392-82091414 GTGCAGAAGCTGCTGGAGCAGGG - Exonic
1152796516 17:82310299-82310321 GAGGAGAATCTTGGGGAGCACGG + Intergenic
1153060663 18:991587-991609 GAGGAGAATCTGCAGTTCCAGGG - Intergenic
1155916021 18:31557781-31557803 GAGGAGATTCTGCAGGAAGAGGG + Intergenic
1155938531 18:31779508-31779530 GAGGATTATGTCCTGGAGCAAGG - Intergenic
1160879225 19:1311913-1311935 GAGAGGAAACTGCTGGACCAAGG - Intergenic
1161606409 19:5217119-5217141 AAGGAGAAGCTGGGGGAGCAGGG + Intronic
1163230471 19:15998469-15998491 GAAGAGAAGTTGCTGGAGCTGGG - Intergenic
1163351562 19:16779369-16779391 GAGGAGAAGCTGCTGGTGATTGG + Exonic
1165061539 19:33207392-33207414 GAGGTGCATCTGCAGGAGCTGGG - Exonic
1166193865 19:41193755-41193777 GAGGAGAAGCTGATGCAGCTGGG + Intronic
1167032602 19:46973268-46973290 CAGGAGAATCTGCTTGAACCTGG + Intronic
1167208575 19:48118916-48118938 GAGGTGAGGCTGCTTGAGCAGGG + Intronic
1167269107 19:48498139-48498161 GAGGAGAAAGCGCTGGAGAATGG - Exonic
1167269119 19:48498184-48498206 GAAGAGAAAGTGCTGGAGAATGG - Exonic
1167378219 19:49123532-49123554 CAGGAGAATTTGCTTGAACACGG - Intronic
1167702074 19:51054743-51054765 GAGGAGCAGCTGCTGGAGCAGGG - Intergenic
1167717644 19:51154219-51154241 GAGGAGAAGGTGATGGAGAAGGG - Intergenic
1168644691 19:58052563-58052585 GTGCAGACTCTGCTGGAGCTGGG - Exonic
925237643 2:2293447-2293469 GAGGCAGATCTGCAGGAGCAGGG + Intronic
925289890 2:2740447-2740469 GAGGAGGACCTGCTGGAGTGAGG + Intergenic
925289926 2:2740627-2740649 GAGGAGCACCTGCTGGAGTGAGG + Intergenic
925289948 2:2740735-2740757 GAGGAGCACCTGCTGGAGTGAGG + Intergenic
925289955 2:2740770-2740792 GAGGAGAACCTGCTGGACTGAGG + Intergenic
926684945 2:15691189-15691211 GAGCAGAACCTGCTGGGCCAAGG - Intronic
927212002 2:20644818-20644840 GTGGAGAGTCTGCGGGAGCCTGG - Intronic
927647018 2:24884281-24884303 GAAGAGAATCACCTGGAGGAGGG - Intronic
928141784 2:28735734-28735756 CAGGAGAATCTGTTGGACCGGGG - Intergenic
930053610 2:47235706-47235728 GAGGTGAAGCTGCTTGAGTAGGG + Intergenic
930525248 2:52520854-52520876 GAGGAGAAACTGCAGGGGCAAGG + Intergenic
931196092 2:60053615-60053637 GAGGAGAAAGTGCTGGTGGAGGG - Intergenic
931849701 2:66239872-66239894 GAGGAGAATGTGCTGGAGAAGGG - Intergenic
932464419 2:71907181-71907203 AAGAAGAATTTGGTGGAGCAAGG - Intergenic
933249598 2:80014256-80014278 GAGCAGAAGCTGCAGGAGGAAGG + Intronic
933671929 2:85016587-85016609 GATGTGAAACTGCTGGAGAAAGG - Intronic
934034436 2:88077296-88077318 GGGGACCAGCTGCTGGAGCAGGG + Intronic
934544820 2:95206126-95206148 TTGGAGATTCTGCTGGAGAAAGG + Intergenic
934857369 2:97737726-97737748 GGGGAGATGCTGCTGGATCAGGG - Intronic
935710230 2:105892088-105892110 CAGGAGAATCTGCTTGAACCTGG + Intronic
935827475 2:106965728-106965750 ATGGAGATTCTGCTGGAGGAGGG + Intergenic
941969753 2:171336958-171336980 CAGGAGAATCTGCTTGAACCAGG - Intronic
942303875 2:174587625-174587647 ATGGAGAATCTGCTGGATCCAGG + Intronic
942312980 2:174672739-174672761 GTAGAGAATCTGCAGGAACAGGG - Intronic
943712085 2:191108196-191108218 GAGGAGAATCTGTTGAACCCGGG + Intronic
943834366 2:192500424-192500446 GAGGAGAAGCAGCTGGATGATGG + Intergenic
945109877 2:206352153-206352175 GAGCAGATTCTGCAGTAGCAGGG + Intergenic
946156604 2:217810969-217810991 TGGGATAATCTGCTAGAGCATGG - Intronic
946968995 2:225070831-225070853 CATGAGAATCTGCTGGCGCTGGG + Intergenic
947005489 2:225506542-225506564 AAGGCCATTCTGCTGGAGCAGGG + Intronic
948807535 2:240459477-240459499 CAGGAGAATCTGCTGGTGACAGG - Intronic
948841035 2:240649061-240649083 GAGGAGAAGCAGCTGGGGCCGGG - Intergenic
1168830357 20:842157-842179 GAGGCGAAGCTGCTTGCGCAAGG + Intronic
1169022586 20:2340715-2340737 GAGGGGGATGTGCTGGAGCCTGG - Exonic
1171111088 20:22483108-22483130 AAGGAGAATGTGCTGTAGCCAGG + Intergenic
1172524060 20:35586974-35586996 GAGGAGAACCTGCTTGGGTAAGG - Intergenic
1172686391 20:36758778-36758800 CAGGAGAATCTGTTGAACCAGGG - Intronic
1173620508 20:44432178-44432200 GGGAACAATCTGTTGGAGCAGGG + Exonic
1176060282 20:63169474-63169496 GAGGAGAAACTTCTAGAGAATGG - Intergenic
1177058435 21:16339067-16339089 TAGGATAATTAGCTGGAGCATGG + Intergenic
1177441637 21:21134159-21134181 CAGGAGAATCTCCTGGACCCGGG - Intronic
1178311915 21:31536684-31536706 GAGGAGAAACGGGTGGAACAGGG + Intronic
1179551273 21:42145535-42145557 GAAGAGAATCTGATGGAGGAGGG + Intergenic
1179592108 21:42415666-42415688 CAGCAGCATCTGCTGGAGGACGG - Intronic
1181673638 22:24437915-24437937 GAGGTGAAGCTGCTGGGGAAGGG - Intronic
1181845308 22:25702970-25702992 GTGGAGAATCTGCTGGTGCACGG + Intronic
1181938091 22:26453249-26453271 AAGCAGAAGCTGCTGAAGCACGG - Exonic
1182655970 22:31890128-31890150 GATGAGAATCAGGTGAAGCATGG - Intronic
1183206753 22:36424759-36424781 GAGGAGAGAGTGCTGGAGCAGGG - Intergenic
1183221163 22:36514333-36514355 GAGGAGACTCTGCAAGGGCAAGG - Intronic
1183380909 22:37490087-37490109 GAGGAGTGTCCCCTGGAGCAGGG - Intergenic
1184175343 22:42785804-42785826 GAGGAGAGGCTGCAGGAGCTGGG + Intergenic
1184486101 22:44780567-44780589 CAGGAGAATCTACTGAACCAGGG + Intronic
1184517798 22:44973469-44973491 GAGGACAGGCTGCTGGAGCCAGG + Intronic
1184550310 22:45200906-45200928 GAGGAGATGCCGCTGGAGCTGGG + Intronic
1185213105 22:49583087-49583109 GAGAAGAAGCTGTTGGAGAATGG + Intronic
949529001 3:4935199-4935221 CAGGAGAATCTCCTGAAGCTGGG + Intergenic
949549775 3:5103327-5103349 CAGGAGAATCAGCTGAACCAGGG - Intergenic
949651074 3:6160205-6160227 GAGTTGCATTTGCTGGAGCAAGG + Intergenic
949777675 3:7650808-7650830 CAGGAGAATCTCTTGGAGCCAGG - Intronic
950265972 3:11573071-11573093 GAGGAGAATCGGCTGAACCCGGG + Intronic
950851727 3:16068426-16068448 GAGGGCAATTTGCTGGAGAAGGG + Intergenic
951222571 3:20084239-20084261 GTGGACAGTCTGCTGGAGAAGGG - Intronic
952428068 3:33195398-33195420 GGGGAGAAACTGCTGGGGGATGG + Intronic
954409844 3:50365664-50365686 GTAGAGAAGCTGCTGGAACAGGG + Exonic
954448843 3:50560972-50560994 GAGCAGGAGCTGCTGGAGCATGG - Exonic
955350842 3:58191923-58191945 GAGGACATCCTCCTGGAGCAGGG + Intergenic
955402623 3:58604032-58604054 GAGGGGCATCTGGTGGGGCAGGG - Intronic
956239415 3:67112845-67112867 AAGGATTATCTGCAGGAGCATGG + Intergenic
956769067 3:72509099-72509121 GAGGAGAATCTTCCAGACCAAGG + Intergenic
960673074 3:120170547-120170569 GAGGAGAGGCTGGTGGAGGAGGG - Intronic
962316860 3:134364472-134364494 GAGGAGAAGCTGCAAGGGCACGG - Intronic
962389748 3:134961254-134961276 CTGGAGAACCTGATGGAGCATGG + Intronic
962403500 3:135081080-135081102 GAGGAGAATCAGGTGAAGGAGGG + Intronic
962821748 3:139055072-139055094 GAGGACACTCTGCTGGTGGAAGG + Intronic
963002448 3:140695015-140695037 GAGGAGAATCTCTTGAAGCCAGG + Intronic
967126773 3:186431092-186431114 GAGGAGGACCTGCAGGAGCCAGG - Intergenic
967158753 3:186717195-186717217 GAGCAGAATCTGATGAAGGAGGG - Intergenic
968572923 4:1351882-1351904 GAGGATGAACTGCTGGACCACGG - Intronic
969681261 4:8644707-8644729 GAGCAGGTCCTGCTGGAGCAAGG - Intergenic
970740829 4:19235670-19235692 GAAGAGAATACACTGGAGCAAGG + Intergenic
973147763 4:46849203-46849225 GGGGAGAAACTGATGGCGCAAGG - Intronic
973542039 4:51944582-51944604 AAGGAGAATTACCTGGAGCATGG + Intergenic
974076124 4:57170153-57170175 GAGGTCAAACTGATGGAGCATGG + Intergenic
975701785 4:77074861-77074883 GAGGAGCCTCCGCTGGAGCTAGG - Intronic
979274820 4:118803370-118803392 GAGGTGAATGTGCTGAAGTACGG - Intronic
981178325 4:141708529-141708551 CAGGAGACTCTCCTGCAGCAAGG + Intronic
981273778 4:142874663-142874685 GAGGAGGATCTCCTGATGCACGG - Intergenic
983762999 4:171437582-171437604 GAGAAAAATCTTCTGGATCAAGG + Intergenic
985255566 4:188066881-188066903 CAGGAGAATCTGCTTGAACCTGG - Intergenic
985575993 5:673723-673745 GAGGTGAATGTGCTGGAGCAGGG + Intronic
985709504 5:1420276-1420298 GAGGAGACTCAGCTGGGCCATGG - Intronic
985902353 5:2806431-2806453 CAGGAGAACCTGCTTGGGCAGGG + Intergenic
986556393 5:9014298-9014320 CAGGAGAATCACCTGGATCAGGG + Intergenic
987464383 5:18254325-18254347 AAGGAGAACCTGCTTGATCAGGG - Intergenic
987680464 5:21129933-21129955 CAGGAGAATCTGTTGTACCAGGG - Intergenic
987812349 5:22853861-22853883 TAGGAGAAATTGCTTGAGCATGG - Intergenic
990283023 5:54271847-54271869 GAGGAGAATCTGCTTGACCCTGG - Intronic
990332671 5:54742976-54742998 GAGAAAAATCTCCTTGAGCAAGG - Intergenic
990487779 5:56276189-56276211 GAGAAGGATCTGCTGGAACCTGG - Intergenic
990540865 5:56771259-56771281 GGGGAGAAGCTGCTGGATCAGGG + Intergenic
993716958 5:91284427-91284449 CAGGAGAATCTCCTGGGGCCAGG + Intergenic
995560900 5:113380737-113380759 GAGGAGAGGCTGCTTGAGCTTGG + Intronic
997269115 5:132520744-132520766 GAGGAGAATCTCTTGAAGCCAGG + Intergenic
997496370 5:134330339-134330361 GAGAGGAATGAGCTGGAGCATGG + Intronic
997847851 5:137304372-137304394 GAGGAAAAGCAGCTGGGGCAGGG - Intronic
997989099 5:138529033-138529055 CAGGAGAATCGGCTTGAGCCTGG + Intronic
999174421 5:149621850-149621872 GAAGAGAAGCTGCTGGAGGTGGG + Exonic
999442511 5:151613465-151613487 GCGGAGAACCTCATGGAGCAAGG - Intergenic
1000915692 5:167078388-167078410 GAGGAGAATCTCTTGGACCCGGG + Intergenic
1001469616 5:172001924-172001946 GAGCAGAATCTGGAGGACCATGG + Intronic
1003108563 6:3234301-3234323 CAAGAGCATCTGTTGGAGCATGG - Intronic
1004849754 6:19686939-19686961 GAGCAGAAACTTCTGGAACAGGG - Intergenic
1005947971 6:30608821-30608843 CAGTAGAATTTGCTGGAGGAGGG + Exonic
1006213794 6:32421028-32421050 GGAGGGAATCTGCTGGAGAAAGG + Intergenic
1007680723 6:43631575-43631597 TGGGAGGATCTGCTTGAGCAGGG - Intronic
1008608422 6:53163605-53163627 GAGGAGAGATTGCTTGAGCAAGG - Intergenic
1013492359 6:110660742-110660764 GAGGAGAAGCAGCTGGAGGTTGG - Intronic
1015096530 6:129420827-129420849 GAGGAGGCTCTGCTGGAGGAGGG - Intronic
1016616288 6:146052408-146052430 GTGGAGGCTCTGCTGGAGCCTGG + Intronic
1017216097 6:151909357-151909379 GAAGAGAATCTGCTGAGGCTGGG + Intronic
1017723409 6:157260045-157260067 GAGGATAATCTGGTGGAGGAAGG - Intergenic
1017913423 6:158814361-158814383 GAGGAAAATCTGATGGGGAAAGG - Intronic
1018710623 6:166495894-166495916 GGGGGGAGTTTGCTGGAGCAAGG + Intronic
1018743001 6:166744544-166744566 GAGGAGACTGCGCTGCAGCAGGG + Intronic
1018970200 6:168522950-168522972 GAGGAGAATGTTCTGGAACTAGG + Intronic
1019571930 7:1716881-1716903 GAGGAGGATCTGCAGGGGCCAGG + Intronic
1019943556 7:4309640-4309662 GGGGAAATTCTGCTGGAGCCTGG - Intergenic
1020774448 7:12435605-12435627 CAGGAGAATCTCTTGGACCAGGG + Intergenic
1022144553 7:27524082-27524104 GAGAAGAGTCTGTAGGAGCAAGG - Intergenic
1022145727 7:27538550-27538572 GAAGAGAACCTGATGCAGCATGG + Intronic
1022591798 7:31670866-31670888 GAGGAGAAGCAGCTGGAGGTCGG + Intergenic
1023282130 7:38581630-38581652 GAAGAGATTCTAGTGGAGCAAGG + Intronic
1023465499 7:40450019-40450041 CAGGAGAATCGCTTGGAGCAAGG - Intronic
1034263607 7:149771712-149771734 GAGGGGAGTCTGCTGGGGGAGGG - Intronic
1034277140 7:149828939-149828961 GAGGAGATGGTGCTGGAGCCAGG + Intergenic
1034421750 7:150994495-150994517 GAGGAGAGGGGGCTGGAGCAGGG - Intronic
1035311948 7:157975089-157975111 GAGGAGAATGTGCTGGGCCTGGG - Intronic
1035512659 8:205034-205056 GAGGAGAAGCTGCTGCTGCAGGG + Intergenic
1035811453 8:2495052-2495074 AAGGAGAATGTATTGGAGCAAGG + Intergenic
1036015220 8:4775671-4775693 GAGGAAAGACTGCTGGACCAAGG + Intronic
1036047284 8:5158011-5158033 GTGGGGAATCTGATGAAGCAGGG - Intergenic
1036609522 8:10337565-10337587 GAGAGGAATCTGCTTGAACATGG - Intronic
1037026155 8:14040619-14040641 GAGGAGAAGCAGAGGGAGCAGGG + Intergenic
1040105929 8:43541970-43541992 GAGGAGAAGGTGCTGGGGCAGGG - Intergenic
1040487637 8:47888930-47888952 CAGGAGCAGCTGCAGGAGCACGG + Intronic
1042260311 8:66852372-66852394 TAGGAGAATCTCCTGAACCAGGG - Intronic
1044613118 8:94113967-94113989 GACGAGAATCTCCAGTAGCATGG - Intergenic
1044717345 8:95112719-95112741 GAGAGGAATCGGCAGGAGCATGG - Intronic
1046478285 8:114778840-114778862 GAGAAGAAGCTGTTGGAGAAAGG - Intergenic
1046578205 8:116058363-116058385 GAGGAGAATAGGCAGGAGGAAGG - Intergenic
1046621930 8:116537394-116537416 GTGGAGAATCCACTGGGGCATGG - Intergenic
1047208652 8:122822848-122822870 GAGGCGTTTCTGCTGGAGCTGGG + Intronic
1047272588 8:123376311-123376333 GAGGAGAATCTCTTGGACCTGGG + Intronic
1047294738 8:123560693-123560715 GAGGAGAACCTGCCAGAGAATGG + Intergenic
1047396502 8:124504837-124504859 CAGGAGAATCTCTTGAAGCAGGG - Intronic
1047743964 8:127830054-127830076 GAAGAGGTTCTGCTGGATCAGGG - Intergenic
1047898099 8:129389057-129389079 GAGAAGAATTTACAGGAGCATGG + Intergenic
1048047159 8:130783627-130783649 GGGGAGGGTCTGTTGGAGCAAGG + Intronic
1048196274 8:132334378-132334400 CAGGAGAATCACCTGGACCAAGG + Intronic
1048486391 8:134851729-134851751 GAGCAGAATCTGCTGGGGATCGG - Intergenic
1049332911 8:142064704-142064726 GAGGGGGATTGGCTGGAGCAAGG + Intergenic
1049464896 8:142746651-142746673 GAGCAGCATTTGCTGGAGGATGG + Intergenic
1050336382 9:4593941-4593963 GAGGAGTATCTGGTGGAGAGAGG - Intronic
1052320329 9:27160548-27160570 GATGAGAATCTGCTCGACCATGG + Intronic
1052431460 9:28371928-28371950 AAGCAGAAAGTGCTGGAGCAAGG + Intronic
1052709966 9:32042154-32042176 GAGGAGCAGCAGCTGGAGGATGG - Intergenic
1053207434 9:36198585-36198607 GAGGAGAATTTGCTTGAACCCGG + Intronic
1053386575 9:37695826-37695848 GTAGAGAATCTGCTGCAACAGGG - Intronic
1053635071 9:39989547-39989569 CAGGAGAATCCGCTGGACCCAGG + Intergenic
1054208816 9:62261150-62261172 CAGGAGAATCCGCTGGACCCAGG - Intergenic
1056108504 9:83371697-83371719 GAGGCCAGGCTGCTGGAGCAAGG - Intronic
1057329304 9:94097929-94097951 GCCGAGAACCTCCTGGAGCAAGG + Exonic
1059111051 9:111558953-111558975 GAGGAGCATCTGCAGGAGAGGGG - Intronic
1059834229 9:118132075-118132097 GAGCAGAAACTTCTGGAGCCTGG - Intergenic
1060233558 9:121843358-121843380 GAGCAGAAGCTTCTGGAGCCAGG + Intronic
1060766614 9:126298718-126298740 CAGTAGAAACAGCTGGAGCAAGG - Intergenic
1060894415 9:127208497-127208519 GATGTGAATCTGCTTGACCAAGG - Intronic
1061817954 9:133207571-133207593 CAGGAGCAGCTGCTGGAGCTGGG - Intronic
1062242445 9:135547603-135547625 CAGGAGCAGCTGCTGGAGCTGGG + Intronic
1062426646 9:136509120-136509142 AGGCAGAATCTGCTGGAGCGGGG - Intronic
1185454639 X:302664-302686 CAGGAGAATTTGCTGGAACCCGG - Exonic
1185653652 X:1667252-1667274 GAGGAGATCATCCTGGAGCAGGG - Intergenic
1187327827 X:18308164-18308186 CAGGAGGATCTGCTTGAGCCTGG + Intronic
1188059130 X:25578700-25578722 GAAGGGAATCTCCAGGAGCATGG + Intergenic
1189924398 X:45937509-45937531 GATGAAAATCTGTGGGAGCAAGG + Intergenic
1195574420 X:106433939-106433961 GAGGAGAAGGTGCTTGACCAAGG + Intergenic
1195812605 X:108851208-108851230 GAGGGGAATCTCCTGATGCATGG - Intergenic
1198075152 X:133187057-133187079 GAGGAAAATCTACTGGATGAAGG + Intergenic
1200048357 X:153414723-153414745 GATGAGAATGTTCTGGAGCCAGG - Intergenic
1200888239 Y:8294066-8294088 AAGGAGAATCACCTGGACCAGGG + Intergenic