ID: 1117538996

View in Genome Browser
Species Human (GRCh38)
Location 14:56728608-56728630
Sequence ACTCCTTCCTATAGCTCTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 154
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 145}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117538994_1117538996 26 Left 1117538994 14:56728559-56728581 CCACAATTAGGAATAAAACAATT 0: 1
1: 0
2: 1
3: 42
4: 400
Right 1117538996 14:56728608-56728630 ACTCCTTCCTATAGCTCTGAAGG 0: 1
1: 0
2: 1
3: 7
4: 145

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117538996 Original CRISPR ACTCCTTCCTATAGCTCTGA AGG Intronic