ID: 1117540017

View in Genome Browser
Species Human (GRCh38)
Location 14:56737864-56737886
Sequence CTGGAGGATAACGATTTAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117540014_1117540017 -5 Left 1117540014 14:56737846-56737868 CCATTATATCACAGGTTTCTGGA No data
Right 1117540017 14:56737864-56737886 CTGGAGGATAACGATTTAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117540017 Original CRISPR CTGGAGGATAACGATTTAGT GGG Intergenic
No off target data available for this crispr