ID: 1117545884

View in Genome Browser
Species Human (GRCh38)
Location 14:56794671-56794693
Sequence CCGCCCTGGAGGGGACCCGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117545873_1117545884 2 Left 1117545873 14:56794646-56794668 CCGGGCCAGCGCTAACCACCGGC No data
Right 1117545884 14:56794671-56794693 CCGCCCTGGAGGGGACCCGGCGG No data
1117545874_1117545884 -3 Left 1117545874 14:56794651-56794673 CCAGCGCTAACCACCGGCCGCCG No data
Right 1117545884 14:56794671-56794693 CCGCCCTGGAGGGGACCCGGCGG No data
1117545871_1117545884 5 Left 1117545871 14:56794643-56794665 CCACCGGGCCAGCGCTAACCACC No data
Right 1117545884 14:56794671-56794693 CCGCCCTGGAGGGGACCCGGCGG No data
1117545870_1117545884 14 Left 1117545870 14:56794634-56794656 CCTTCGCATCCACCGGGCCAGCG No data
Right 1117545884 14:56794671-56794693 CCGCCCTGGAGGGGACCCGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117545884 Original CRISPR CCGCCCTGGAGGGGACCCGG CGG Intergenic
No off target data available for this crispr