ID: 1117546493

View in Genome Browser
Species Human (GRCh38)
Location 14:56798096-56798118
Sequence CGGCGAAAGCAAGCCCAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117546493_1117546501 4 Left 1117546493 14:56798096-56798118 CCCTGCTGGGCTTGCTTTCGCCG No data
Right 1117546501 14:56798123-56798145 GGCCCCTTCTCCCCGGCCAGTGG No data
1117546493_1117546497 -3 Left 1117546493 14:56798096-56798118 CCCTGCTGGGCTTGCTTTCGCCG No data
Right 1117546497 14:56798116-56798138 CCGCCCCGGCCCCTTCTCCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117546493 Original CRISPR CGGCGAAAGCAAGCCCAGCA GGG (reversed) Intergenic
No off target data available for this crispr